ID: 1019119181

View in Genome Browser
Species Human (GRCh38)
Location 6:169789907-169789929
Sequence CTTTAGTAAAGGAGCTGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 133}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019119167_1019119181 28 Left 1019119167 6:169789856-169789878 CCTGTACATCTTTCCCCCACCCC 0: 1
1: 0
2: 3
3: 35
4: 334
Right 1019119181 6:169789907-169789929 CTTTAGTAAAGGAGCTGATGGGG 0: 1
1: 0
2: 1
3: 15
4: 133
1019119168_1019119181 15 Left 1019119168 6:169789869-169789891 CCCCCACCCCCACTCATAGCCTC 0: 1
1: 0
2: 7
3: 68
4: 795
Right 1019119181 6:169789907-169789929 CTTTAGTAAAGGAGCTGATGGGG 0: 1
1: 0
2: 1
3: 15
4: 133
1019119176_1019119181 6 Left 1019119176 6:169789878-169789900 CCACTCATAGCCTCGGATTCTCT 0: 1
1: 0
2: 1
3: 17
4: 202
Right 1019119181 6:169789907-169789929 CTTTAGTAAAGGAGCTGATGGGG 0: 1
1: 0
2: 1
3: 15
4: 133
1019119175_1019119181 7 Left 1019119175 6:169789877-169789899 CCCACTCATAGCCTCGGATTCTC 0: 1
1: 0
2: 1
3: 8
4: 102
Right 1019119181 6:169789907-169789929 CTTTAGTAAAGGAGCTGATGGGG 0: 1
1: 0
2: 1
3: 15
4: 133
1019119170_1019119181 13 Left 1019119170 6:169789871-169789893 CCCACCCCCACTCATAGCCTCGG 0: 1
1: 0
2: 0
3: 19
4: 180
Right 1019119181 6:169789907-169789929 CTTTAGTAAAGGAGCTGATGGGG 0: 1
1: 0
2: 1
3: 15
4: 133
1019119169_1019119181 14 Left 1019119169 6:169789870-169789892 CCCCACCCCCACTCATAGCCTCG 0: 1
1: 0
2: 0
3: 33
4: 279
Right 1019119181 6:169789907-169789929 CTTTAGTAAAGGAGCTGATGGGG 0: 1
1: 0
2: 1
3: 15
4: 133
1019119172_1019119181 12 Left 1019119172 6:169789872-169789894 CCACCCCCACTCATAGCCTCGGA 0: 1
1: 0
2: 2
3: 9
4: 129
Right 1019119181 6:169789907-169789929 CTTTAGTAAAGGAGCTGATGGGG 0: 1
1: 0
2: 1
3: 15
4: 133
1019119173_1019119181 9 Left 1019119173 6:169789875-169789897 CCCCCACTCATAGCCTCGGATTC 0: 1
1: 0
2: 1
3: 11
4: 133
Right 1019119181 6:169789907-169789929 CTTTAGTAAAGGAGCTGATGGGG 0: 1
1: 0
2: 1
3: 15
4: 133
1019119174_1019119181 8 Left 1019119174 6:169789876-169789898 CCCCACTCATAGCCTCGGATTCT 0: 1
1: 0
2: 0
3: 13
4: 115
Right 1019119181 6:169789907-169789929 CTTTAGTAAAGGAGCTGATGGGG 0: 1
1: 0
2: 1
3: 15
4: 133
1019119177_1019119181 -4 Left 1019119177 6:169789888-169789910 CCTCGGATTCTCTGCACAGCTTT 0: 1
1: 0
2: 0
3: 8
4: 107
Right 1019119181 6:169789907-169789929 CTTTAGTAAAGGAGCTGATGGGG 0: 1
1: 0
2: 1
3: 15
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019119181 Original CRISPR CTTTAGTAAAGGAGCTGATG GGG Intergenic
901165407 1:7217922-7217944 CTTTGGCAAAGGAACTTATGGGG - Intronic
901738185 1:11325471-11325493 CTTGCGGAAAGGAGGTGATGGGG + Intergenic
903749438 1:25611652-25611674 CCTCAGTGAAGGAGCTGAAGGGG + Intergenic
904355827 1:29939120-29939142 ATTTAGAAATGGAGCTAATGTGG + Intergenic
904499436 1:30905753-30905775 CTTAAGTACAGTAGCTGAGGTGG + Intronic
912047566 1:105479455-105479477 CTTTAGTAAACCTCCTGATGGGG - Intergenic
913229693 1:116731505-116731527 CTTAAGTAAATGAGGAGATGTGG - Intergenic
914437005 1:147669647-147669669 CTTGAGCAAAGGACCTGCTGGGG - Intronic
923420251 1:233807361-233807383 CTTTAGTAAAGGATCTTCTTTGG - Intergenic
1067158359 10:43801683-43801705 CTTAACTAGAGGAGCTGAGGTGG + Intergenic
1068559285 10:58495129-58495151 CTTTAGCAGAGGAGCAGATATGG + Intergenic
1069050186 10:63784452-63784474 CTTTAGTAAAGAATCTGATGGGG - Intergenic
1071826483 10:89330780-89330802 CTTTATTTATGGAGCTAATGTGG - Intronic
1072383961 10:94904826-94904848 CTTTTGTAGAAAAGCTGATGAGG + Intergenic
1072668931 10:97415105-97415127 CTTCCGTAAAGGAGAAGATGAGG + Intronic
1076513189 10:131026562-131026584 TTTTAATAAGGGAGCCGATGGGG + Intergenic
1077455695 11:2678602-2678624 CTTAAGTAATGGAGATGAGGGGG - Intronic
1081491150 11:43569941-43569963 CTTTAGAGAAGGAGCTGAGTTGG - Intronic
1085825816 11:79846175-79846197 CTTCAGTAAAGCAGTTGCTGTGG + Intergenic
1087311773 11:96552453-96552475 CTTAAGTAGAGGTGCTGCTGTGG + Intergenic
1092166556 12:6346271-6346293 CTTTAGTAAAGGAGAGACTGAGG - Intergenic
1092836704 12:12496533-12496555 CTTTAGAAAAGAAGCTGCAGTGG + Intronic
1092908594 12:13124945-13124967 TTTTAGTAAATGAGATGGTGGGG - Intronic
1095670874 12:44858549-44858571 GATTAGTGAAGGAGCTGTTGGGG - Intronic
1095717294 12:45360381-45360403 CCTTATAAAAGGAGTTGATGAGG - Intronic
1104315489 12:127696448-127696470 TTATAGTAAAGGTGCTGATGTGG + Intergenic
1108753661 13:53474524-53474546 CTTTAGAAAAAGAGATAATGAGG + Intergenic
1109616936 13:64847672-64847694 TTTTAATAAAGGAGCTAGTGGGG + Intergenic
1111473803 13:88720716-88720738 TTTTAGCAAAGCAGATGATGTGG + Intergenic
1111637629 13:90926767-90926789 CTTCAGAAAAGGACATGATGTGG - Intergenic
1113360920 13:109630803-109630825 CTTCAGGGAAGGAGCTGCTGGGG - Intergenic
1114785846 14:25597578-25597600 CATGAGTAAATGAGCTGATGTGG + Intergenic
1117217521 14:53567389-53567411 GTTTAGCAAAGGAGCTGACCTGG + Intergenic
1118108342 14:62687011-62687033 CTCTAGTAATGGAGATCATGTGG + Intergenic
1120216370 14:81684613-81684635 GTCTAGTACAGGATCTGATGGGG + Intergenic
1123203413 14:106690507-106690529 CTTAGGTAAAGGAGTGGATGTGG + Intergenic
1123578903 15:21698553-21698575 CTTTAGTGAAGGAGTTTCTGAGG + Intergenic
1123615530 15:22141035-22141057 CTTTAGTGAAGGAGTTTCTGAGG + Intergenic
1124021223 15:25925825-25925847 CTTCAGTTAAAAAGCTGATGTGG + Intergenic
1126380111 15:48037842-48037864 GTTTAGTAGAACAGCTGATGTGG + Intergenic
1126788875 15:52202569-52202591 GTTTAGCAAAGGCTCTGATGTGG + Intronic
1127464544 15:59231459-59231481 CCTTAGTAAGGCAACTGATGTGG + Intronic
1128078911 15:64844672-64844694 CTATAGTAAAGGGGTTGAGGGGG + Intronic
1128986669 15:72227038-72227060 CTTTGTTAAAGAAGCTGTTGGGG - Intronic
1130530724 15:84746547-84746569 CTTAACTAAAGGAGCTGAGAGGG - Intergenic
1202987773 15_KI270727v1_random:432798-432820 CTTTAGTGAAGGAGTTTCTGAGG + Intergenic
1133066381 16:3210345-3210367 CTTTGGTTATGGAGGTGATGTGG + Intergenic
1136912167 16:34153545-34153567 TTTAAGTCAAGGAGCTGATCAGG - Intergenic
1137765527 16:50975001-50975023 CTTTAGCAAAGGAGTAGATAGGG + Intergenic
1137874602 16:51984151-51984173 GTTTAATTCAGGAGCTGATGGGG - Intergenic
1138766336 16:59609684-59609706 GTATAAAAAAGGAGCTGATGAGG + Intergenic
1138794635 16:59953121-59953143 CTTTAGAAGAGAAGCTGATGAGG + Intergenic
1141171647 16:81695507-81695529 CTTTCCTAAAGGAAATGATGAGG + Intronic
1143544342 17:7587721-7587743 CCTTAGAAAAGGAGAGGATGGGG + Exonic
1144327031 17:14192330-14192352 TTTTAGCAAATGTGCTGATGTGG + Intronic
1144475917 17:15589193-15589215 TTTTAGCAAATGTGCTGATGTGG + Exonic
1146409778 17:32572592-32572614 TTTTAGCAAAGGGGGTGATGTGG - Intronic
1147191809 17:38742256-38742278 ATGTTGTAAAGGAGCTGTTGGGG - Intronic
1149423802 17:56535507-56535529 GTTCAGTAATGGAGTTGATGAGG + Intergenic
1156576513 18:38323158-38323180 CTTTAATAGAGGATCTAATGTGG - Intergenic
1157590939 18:48836139-48836161 CTTTAGAGAAGCAGCTGCTGGGG - Intronic
929637662 2:43541708-43541730 CTTTAGTCCAGGAGGTGATGTGG - Intronic
933807025 2:86006178-86006200 CTGTAGTCAAGGTGCGGATGGGG - Intergenic
935026603 2:99283011-99283033 AATTAGAAAAGGAGCTGATATGG + Intronic
935249387 2:101248286-101248308 CTTTAGAAAAGGACGTGATGGGG + Intronic
936887540 2:117331055-117331077 CTTGAGCAAAGGAGGTGTTGGGG - Intergenic
938091828 2:128439576-128439598 CTTTAGTAAAGGAGTTTCGGGGG - Intergenic
940696040 2:156979621-156979643 CTTTGGGGTAGGAGCTGATGTGG + Intergenic
941731976 2:168928006-168928028 CTTTAGTGAATCAGCTCATGTGG - Intronic
946254758 2:218434461-218434483 ACTTAGTAAAGAAGATGATGGGG - Intronic
1169506223 20:6214039-6214061 TTCTAGTAAAGGACCAGATGAGG + Intergenic
1171270824 20:23815512-23815534 CTTAAGTAAGGAAGTTGATGTGG + Intergenic
1171958760 20:31478357-31478379 CTTTAAAAAACTAGCTGATGAGG - Intronic
1172278872 20:33696535-33696557 GTGTCCTAAAGGAGCTGATGTGG + Intergenic
1172900256 20:38329498-38329520 CTAAAGTAAAGGAGCTGGAGAGG + Intronic
1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG + Intronic
1175964122 20:62651969-62651991 CTTCTGCAAAGGATCTGATGGGG - Intronic
1177528163 21:22325222-22325244 ATTTAGGAAAGTAGCAGATGTGG + Intergenic
1178883634 21:36467594-36467616 CTTTGGTAAAGGCGGTGGTGGGG + Intronic
1179098136 21:38333960-38333982 CTTTACAAAAGGAGCTGAGGAGG - Intergenic
1182083501 22:27545434-27545456 CTGTTATGAAGGAGCTGATGTGG - Intergenic
1182243253 22:28934305-28934327 CTTTGGAAAAAGAGCTGATGAGG + Intronic
1183281767 22:36936113-36936135 CTTCAGGAAGGGAGCTGAAGGGG + Intronic
950756458 3:15177388-15177410 ATTTATAAAAAGAGCTGATGAGG + Intergenic
950769290 3:15298382-15298404 CTTTAGGAAAGGAGATGAGTGGG - Intronic
952212090 3:31238254-31238276 CTTCAGTAAAAGAGCTTCTGTGG + Intergenic
952392674 3:32893704-32893726 CAATAGAAAAGGAGATGATGGGG + Exonic
955005710 3:54966457-54966479 CTTTAGTAAATCAGCTGTTGGGG - Intronic
955894808 3:63687803-63687825 CTTTAGTTAAGCAGCTGCTCTGG + Intergenic
955924322 3:63990646-63990668 CTTCAGGAAAGGAGCTAATCAGG - Intronic
960040238 3:113143187-113143209 ATTTAGTAAGGGAGATGTTGGGG - Intergenic
964922569 3:161915211-161915233 CTATATTAAAAGTGCTGATGTGG + Intergenic
965953605 3:174340779-174340801 CTTTAGCAAGGCAGTTGATGAGG - Intergenic
967961903 3:194932211-194932233 CTGTAGTAAAGGAATGGATGAGG + Intergenic
970794293 4:19892909-19892931 CATTTGTAAAGCAGCAGATGAGG + Intergenic
971815647 4:31484799-31484821 CCTTAGTAAACAAGCTAATGTGG - Intergenic
972859059 4:43144804-43144826 CTTTAATAAAGGACCTTCTGTGG + Intergenic
975840014 4:78464025-78464047 CTTGAGTAAAGGAACTAATCTGG - Intronic
975956830 4:79850683-79850705 CTTTAGAAAAGTACCTAATGAGG + Intergenic
978448456 4:108803354-108803376 TTTTAGTTAAGGCACTGATGAGG + Intergenic
981969724 4:150652929-150652951 CATTAGGAAAGAAGCTGATATGG - Intronic
986063500 5:4213567-4213589 CTTAAGTAAGGGGCCTGATGGGG + Intergenic
986080745 5:4390909-4390931 CTTTAATAAAGAATTTGATGAGG - Intergenic
988832356 5:35000141-35000163 CTTTAGTAGAGTGGTTGATGAGG - Intronic
990119755 5:52436621-52436643 CTTTAGAAAAGGATATCATGAGG - Intergenic
991450593 5:66746669-66746691 CTTTAGTTATGTTGCTGATGGGG + Intronic
992868985 5:80987066-80987088 CTGTAGAAAAGGAGCTCATCTGG - Intronic
993186777 5:84631917-84631939 TTGTAGTAAAGGAGCTGGTAAGG - Intergenic
997139793 5:131366207-131366229 TTATATTAAAGGAGCTGAAGAGG - Intronic
997459659 5:134043303-134043325 ATATAGAAAAGGAGCTGCTGAGG + Intergenic
1000655990 5:163878452-163878474 CATTAGTAAAGCACCTGAAGTGG - Intergenic
1002910822 6:1489676-1489698 CTTTATTAGAGGAGCAGATGAGG - Intergenic
1011112008 6:83849177-83849199 CTTTAGTAAAGCAGGTGTGGTGG - Intergenic
1011276826 6:85640232-85640254 TTCTAGTAAAGGACCAGATGAGG - Exonic
1011463239 6:87627879-87627901 CTTAAGAAAATGAGGTGATGGGG - Intronic
1012531275 6:100240080-100240102 CTATAGTAAACAAGCTAATGTGG + Intergenic
1015218798 6:130780869-130780891 TTTTTGCAATGGAGCTGATGAGG + Intergenic
1015458459 6:133458626-133458648 CTTTAGTAAAGAAGCATCTGGGG - Intronic
1016731793 6:147435487-147435509 CTTTGGGAAAGGAGGTGAGGAGG - Intergenic
1017246073 6:152226726-152226748 CTTGGGTAAAAGAGCTGGTGAGG + Intronic
1018040662 6:159918934-159918956 GTTCAGTAAAAGGGCTGATGTGG + Intergenic
1019119181 6:169789907-169789929 CTTTAGTAAAGGAGCTGATGGGG + Intergenic
1024001208 7:45190491-45190513 CCTTAGTCAAGGAGCTGACCAGG + Intergenic
1036027789 8:4929126-4929148 CTTTATAAAAGGAGAAGATGTGG + Intronic
1036425589 8:8642646-8642668 CTTTAGAAAAGGTGCAGAGGGGG - Intergenic
1041241605 8:55853518-55853540 CTTTAATAAAGGAGGTGGCGGGG - Intergenic
1047011238 8:120674401-120674423 CTTTACTCATGGAGCTGGTGAGG + Intronic
1049763353 8:144341056-144341078 CTTTAGTGAAGGTGCTTATTGGG - Intergenic
1049881594 8:145068169-145068191 CTTGAGTAAAGGAGATGCTAGGG + Intergenic
1050617390 9:7416435-7416457 CTCTAGTAATGGAGATGATGTGG + Intergenic
1053456097 9:38234097-38234119 CTCTAGGAAAAGAGCTGAAGGGG + Intergenic
1054812615 9:69446882-69446904 CTTAAGTAAAGGTGGGGATGGGG - Intronic
1055024062 9:71700538-71700560 GTTTAGTGAAGCAGCTGATGTGG - Intronic
1055912679 9:81370369-81370391 CGTTGGTTAATGAGCTGATGTGG - Intergenic
1057532632 9:95865759-95865781 GTTAAGAAAAGGAGATGATGGGG - Intergenic
1058023221 9:100112861-100112883 CTTTAGTAAAGGAGAGGATTAGG - Intronic
1058578811 9:106432410-106432432 TTTTAGTGAAGGAGCTACTGTGG + Intergenic
1060022711 9:120146067-120146089 CTATACTAAAGGGCCTGATGTGG + Intergenic
1060701654 9:125756825-125756847 ATTTAGAAAAGCAGCTAATGTGG - Intronic
1062505739 9:136874995-136875017 CTGTAATAAAGAAACTGATGGGG + Intronic
1187251783 X:17605549-17605571 CTATACTAAAGGGGCTGAGGTGG - Intronic
1190597837 X:52065014-52065036 CTTCAGTGTAGGTGCTGATGTGG - Intronic
1190610987 X:52189059-52189081 CTTCAGTGTAGGTGCTGATGTGG + Intronic
1192628676 X:72757330-72757352 CTCTAGTAATGGAGATGATGTGG - Intergenic
1192653032 X:72963484-72963506 CTCTAGTAATGGAGATGATGTGG + Intergenic
1193634405 X:83930454-83930476 CGTTATTATAGGAGCTGATATGG - Intergenic
1195070824 X:101277592-101277614 CTTTACTAAAGTACCTGACGAGG + Exonic
1198546826 X:137701394-137701416 TTTTAGTAAAGAGGCTGAGGTGG + Intergenic
1198613904 X:138432587-138432609 CTTTAGTGAAGAAGGTGATGAGG + Intergenic
1198735737 X:139783232-139783254 CTTTTGTAAAGGAGCAGACTCGG - Exonic