ID: 1019119379

View in Genome Browser
Species Human (GRCh38)
Location 6:169791014-169791036
Sequence CTGGAGTCCCTAGGAAATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019119379_1019119383 7 Left 1019119379 6:169791014-169791036 CCTGGATTTCCTAGGGACTCCAG 0: 1
1: 0
2: 0
3: 8
4: 144
Right 1019119383 6:169791044-169791066 GGCATCGATGTCAGTTAACTTGG 0: 1
1: 0
2: 0
3: 3
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019119379 Original CRISPR CTGGAGTCCCTAGGAAATCC AGG (reversed) Intergenic
900950602 1:5856347-5856369 CTGGAGTCCCTACTCAATTCAGG + Intergenic
901177131 1:7312264-7312286 CTGCAGCCCCCAGGCAATCCTGG - Intronic
906163160 1:43666087-43666109 CTGGAGAACATAGGAAAGCCTGG + Intronic
910371707 1:86523744-86523766 CTGGCTTCCCTAGGGGATCCAGG + Intergenic
915604877 1:156944181-156944203 TTGGAGGCTCTAGGAAGTCCTGG + Intronic
915674082 1:157514813-157514835 GTGCACTCCCTAGGAAATCCGGG - Exonic
920676668 1:208042993-208043015 CTGGATTTCCTAGGATACCCTGG + Intronic
924552089 1:245088541-245088563 CCGGAGTCCCTAACGAATCCAGG + Intronic
1064925723 10:20566679-20566701 AAGGAGTCCCTGGGAAATCTTGG + Intergenic
1069806819 10:71131540-71131562 CTGGAGTCCTTGGGAGATCTAGG - Intergenic
1071334998 10:84593458-84593480 TTGGAGTTCCTAGGAAAGTCAGG + Intergenic
1074714689 10:116207385-116207407 CTGGCTTCTCTAGAAAATCCTGG + Intronic
1076493939 10:130884649-130884671 CGGGAGTGCCTGGGAAATCTAGG - Intergenic
1076550775 10:131276891-131276913 CTGGAGTTTGTAGGGAATCCTGG - Intronic
1080850927 11:36069260-36069282 CTGGATTCTCCAGGAAATCTGGG - Intronic
1082987022 11:59177878-59177900 TTGGAGTGCCTAGGACATGCAGG + Intronic
1087524841 11:99296696-99296718 CTGGACTCCCTGGGAAAAACAGG - Intronic
1089557051 11:119320601-119320623 CTGCGGTCCCTGGGAAAGCCAGG - Intronic
1089595139 11:119573814-119573836 CTGCAGGCCCTGGGAAATGCAGG + Intergenic
1090041053 11:123291798-123291820 CTGCAGTTCATAGGAAATACAGG + Intergenic
1092252787 12:6910129-6910151 CTGGATTCTCAAGGAAAGCCCGG + Intronic
1094125057 12:27014530-27014552 CGGGAGCCCCCAGGAAGTCCTGG + Intergenic
1100084397 12:90891143-90891165 CTGGAGTTCCAAGGTCATCCGGG - Intergenic
1103524882 12:121561005-121561027 CTGGCCTGCCTAGGAACTCCAGG - Intronic
1105679355 13:22709800-22709822 ATGGAGTCCCCAGGCAATTCTGG + Intergenic
1112598490 13:100831817-100831839 CTGGAGTCACTAGCAAGTCAAGG + Intergenic
1113438698 13:110311879-110311901 CTGGAGCCCCGAGGACAGCCTGG - Intronic
1114220341 14:20690562-20690584 CTTGATTCCCTAAGACATCCAGG - Intronic
1114544431 14:23488162-23488184 CTGGAGCACCAAGAAAATCCAGG + Intronic
1114802876 14:25798131-25798153 CTGGAGTCCCTATCAATTCCTGG - Intergenic
1114897880 14:27014668-27014690 ATGGAGTCCCTATGAACTCAAGG - Intergenic
1115721265 14:36163358-36163380 CTGGATTCCATAGGAAATAAAGG - Intergenic
1115870992 14:37802431-37802453 CTGGAGTCTCAAGGAAATGAAGG + Intronic
1116013426 14:39378000-39378022 CTGGAGCCCCTTGGAAAAACTGG - Intronic
1118681260 14:68244280-68244302 CTGCATTTCCTAGGAAATCGAGG + Intronic
1119777807 14:77259245-77259267 CTGGAGGCTCTAGGCAATACCGG - Exonic
1123797030 15:23782530-23782552 CTGGAGTCCCTGTGACAACCAGG - Intergenic
1127385786 15:58465607-58465629 ATGGAGTCCCAAGTGAATCCAGG + Intronic
1128471955 15:67961904-67961926 CTGGAGCCCCCAGATAATCCTGG + Intergenic
1128936334 15:71749451-71749473 CTGGATTCTCTAGGAGATCTAGG + Intronic
1129069555 15:72939309-72939331 TGGGGGTCCCTCGGAAATCCTGG + Intergenic
1131168215 15:90158118-90158140 CTGGAGTCTCCTGGAACTCCTGG - Intergenic
1132593226 16:735588-735610 CTGGTGTCCCAGGGAAAACCTGG - Intronic
1133054986 16:3141442-3141464 CTGGGGTCCCTCGGACAGCCCGG - Exonic
1134635004 16:15785530-15785552 CTGGAGGCCCTTGGAGATCTAGG - Intronic
1134778167 16:16871131-16871153 CTGGATTCCCTGGAAATTCCTGG + Intergenic
1136078028 16:27830286-27830308 CTGGAGCTCCCAGGAAATGCAGG - Intronic
1136511768 16:30742367-30742389 CTGGAGGCCCTTGGGAATCTGGG - Intronic
1137036842 16:35575287-35575309 CTCGGGTCCCTAGGAGGTCCGGG - Intergenic
1139094022 16:63683253-63683275 CTGGACTCCATAGTATATCCAGG + Intergenic
1140381024 16:74487934-74487956 CTGGCATGCCTAGGAAAACCTGG + Intronic
1143610892 17:8016732-8016754 CTGGAGTGGTTTGGAAATCCAGG + Intronic
1144381277 17:14701056-14701078 AGGAAGTCCCAAGGAAATCCAGG + Intergenic
1146065416 17:29631178-29631200 CAAGAGTCCCTAGAAAACCCAGG - Exonic
1148243196 17:46013250-46013272 CTGGAGGCCCTGGGGACTCCAGG + Intronic
1148271155 17:46262915-46262937 CTAGAGTAACAAGGAAATCCGGG + Intergenic
1148905492 17:50909376-50909398 CTGGAATCCCTAGCACAACCAGG + Intergenic
1151435196 17:74091123-74091145 CTGCTGTCCCTAGGATATCCTGG + Intergenic
1151817105 17:76476794-76476816 CTGGAGCCCCCAGGAGAGCCTGG - Intronic
1153594935 18:6715756-6715778 CTGGGGGCCCTGGGAAATTCTGG + Intergenic
1155148466 18:23103708-23103730 CTGGAGGCCCCAGAAAAACCAGG + Intergenic
1160100462 18:75916021-75916043 CTGGAGACCCCAGGAGATCCAGG + Intergenic
1165117397 19:33537171-33537193 CTAGAGTCCCTTGGTCATCCTGG - Intergenic
1168543944 19:57234778-57234800 GTGGAGACCCTAGGACACCCTGG - Intronic
926616887 2:15004939-15004961 CTGGATTCCTTAGGAAAAGCTGG + Intergenic
929631136 2:43463334-43463356 GTGGAGTCCTTTGGAAATCTTGG + Intronic
929868753 2:45740287-45740309 CAGGAGTCCCTAGGGAATGTGGG + Intronic
932196153 2:69785834-69785856 CTTGAGCTCATAGGAAATCCAGG - Intronic
932323543 2:70839136-70839158 CAGGAGTCCCTATGTAAGCCAGG - Intergenic
937999227 2:127719456-127719478 CTGGAGGCCCTCGCAATTCCTGG + Exonic
940305561 2:152222135-152222157 CTGAAGTGCCAAGGAAATTCTGG + Intergenic
940842465 2:158599715-158599737 ATGGAGTCTCTAGGAAGGCCAGG + Intronic
940892051 2:159044672-159044694 CAGGAGTCCCCAAGACATCCAGG + Intronic
941482764 2:166038274-166038296 TTGGACTCCCTAGGAAAAGCTGG + Intronic
942940270 2:181607498-181607520 CTGGATTCCCCAAGAAGTCCTGG + Intronic
1169923740 20:10761461-10761483 CTCAAGTTCCTATGAAATCCTGG - Intergenic
1172186779 20:33035835-33035857 CTGAAGTCCCCAGGGAATCTGGG + Intronic
1172787712 20:37480120-37480142 CTGGAGTCCATAGGAGAACTTGG - Intergenic
1173062922 20:39679571-39679593 CTGTAATTCCAAGGAAATCCAGG - Intergenic
1178781093 21:35604048-35604070 CTGCAGCCTCTAGGAAATTCAGG + Intronic
1178971488 21:37181792-37181814 ATGGATTCCATAGGAAATCATGG - Intronic
1180841821 22:18962468-18962490 CTGGAGTCCCCAGGACCACCAGG + Intergenic
1181458828 22:23074321-23074343 CTGGAGGCCCTGAGAAATGCAGG + Intronic
1184981822 22:48100655-48100677 CAGGAGTCCCAGGGAGATCCAGG - Intergenic
950647980 3:14389087-14389109 ATAGAGTCCCTAGGAGATCTGGG - Intergenic
953924015 3:46971698-46971720 CTGGAGGCCTTAGGAATTTCAGG - Intronic
957195234 3:77059244-77059266 TTGGAGTCCCTTTGAAAGCCTGG + Intronic
960602988 3:119476707-119476729 CTAGATTCCCTGGGAAATCAGGG - Intronic
960975447 3:123169602-123169624 GTGGAGGTCCAAGGAAATCCTGG - Intronic
961498686 3:127315173-127315195 GTGGAATCCCAAGGAAGTCCAGG + Intergenic
962267365 3:133953504-133953526 CTGCAGTCCCTCGGAGAGCCAGG - Intronic
969827781 4:9771762-9771784 CTGGAGTCTTGAGGAGATCCTGG + Intronic
971474745 4:27062023-27062045 CTGGAGTCGATGGAAAATCCTGG + Intergenic
972708286 4:41567590-41567612 CTTTATTCCCTAGGAAAACCTGG + Intronic
972720883 4:41696958-41696980 CTGGAGTCTGTTTGAAATCCGGG - Intronic
973972388 4:56226454-56226476 CTGGAGTCCCTAAGGAATGGAGG - Intronic
983163610 4:164447992-164448014 ATAGAGTCCCAAGGAAATCCTGG + Intergenic
983252893 4:165364971-165364993 GTGGAGCCCTGAGGAAATCCAGG + Intronic
985767353 5:1787037-1787059 AGGGCCTCCCTAGGAAATCCGGG - Intergenic
986173457 5:5332320-5332342 CTGGTCTCCCCAGGAAAACCAGG + Intergenic
988180226 5:27781801-27781823 CTGGTGTTCCAGGGAAATCCTGG - Intergenic
990669832 5:58115630-58115652 CTGGAGTTCCTGGGAAAGTCTGG - Intergenic
990674520 5:58168511-58168533 CGGAAGTCCCTAGGCAAACCTGG + Intergenic
996976475 5:129440524-129440546 CTGGAGAGCCTAGGAACTGCTGG + Intergenic
997992246 5:138554301-138554323 CTGGAGTACTTTGGAAATCCTGG + Intergenic
999222530 5:149992621-149992643 CTGGAGTCTCCAAGAAAGCCTGG + Intronic
999698306 5:154205492-154205514 CTGCAGTCCTTGGGAAAGCCTGG - Intronic
1000210639 5:159104002-159104024 CTGGAGTCCCCAGAAATTACTGG - Intergenic
1004842215 6:19600066-19600088 CTGTAGAACCTACGAAATCCAGG + Intergenic
1006297015 6:33174199-33174221 CAGGGGTCCCTAGGATTTCCTGG - Exonic
1006786264 6:36669365-36669387 ATGGAGACCCTAGGAAGTGCTGG - Intergenic
1006913999 6:37583072-37583094 CTGGGGTCCCGGGCAAATCCTGG + Intergenic
1012914439 6:105154544-105154566 CTGCAGCCCCTAGGAACTCATGG - Intergenic
1017441237 6:154466263-154466285 CTGGAGCCCTTAGGATATACAGG - Intronic
1019119379 6:169791014-169791036 CTGGAGTCCCTAGGAAATCCAGG - Intergenic
1019442787 7:1055878-1055900 CTTGAGTCCCCAGGAAACACAGG - Intronic
1022077221 7:26983803-26983825 CTGGACTTCCTAGGGCATCCTGG - Intronic
1022077222 7:26983804-26983826 CAGGATGCCCTAGGAAGTCCAGG + Intronic
1022548246 7:31209313-31209335 CTGGAGTCACTGGGAAATCGTGG + Intergenic
1026329137 7:69336902-69336924 CTGCATTCCCTGGGAATTCCAGG + Intergenic
1026634029 7:72065578-72065600 CTGGAGTCCCATTGAGATCCCGG + Intronic
1028150066 7:87361810-87361832 ATGGAGTCTCTAGTAATTCCTGG - Exonic
1029324520 7:99794573-99794595 CTGGAGTCCATAGAAAGCCCAGG - Intergenic
1031305068 7:120115718-120115740 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1032584759 7:133135980-133136002 CTGGAGGCACTAGGGAATCTGGG + Intergenic
1033316594 7:140302605-140302627 ATGGATTCCCTGGGAGATCCAGG - Intronic
1033822859 7:145154923-145154945 CAGGAGTGCCTTGTAAATCCTGG + Intergenic
1035236200 7:157499111-157499133 CAGGAGTCCCTCGGAAATAGTGG + Intergenic
1037975083 8:23203456-23203478 CTGGAGACCCTCTGCAATCCAGG - Intronic
1044032827 8:87259772-87259794 CTGGACTCCTTAGGAAAAACAGG - Intronic
1044192336 8:89333690-89333712 CTTGTGTCTCTAGGAATTCCTGG + Intergenic
1048985621 8:139733278-139733300 CTGGAGCCCCTAGGAACTGAAGG + Intronic
1049417941 8:142504113-142504135 CTGGGGTCCTGAGGAGATCCTGG - Intronic
1049500526 8:142960955-142960977 CTGGACTCCCTGGGAAAAACAGG + Intergenic
1049521287 8:143092722-143092744 CTGCAGTGCCCAGGAAAGCCTGG + Intergenic
1049749880 8:144278040-144278062 CTGGAGACCCTGGAGAATCCGGG - Intronic
1049766595 8:144358087-144358109 CCGCATTCCCTTGGAAATCCTGG - Exonic
1053311448 9:37023383-37023405 CTGGAGTCCATAGGAAGTACAGG - Intronic
1053346583 9:37382835-37382857 CAGGAGGCCCTGGGAAATCTGGG - Intergenic
1053814917 9:41897841-41897863 CTGTATTCCCTAGGACATGCGGG - Intronic
1054615679 9:67289600-67289622 CTGTATTCCCTAGGACATGCGGG + Intergenic
1055681207 9:78717396-78717418 CAGCAAGCCCTAGGAAATCCGGG - Intergenic
1055775737 9:79765360-79765382 CAGAAATCCCTAGGAAATCAAGG + Intergenic
1061245249 9:129398301-129398323 CTGGAGACCAGAGGAAAGCCAGG + Intergenic
1061494279 9:130962846-130962868 GTGGCGTCCCTAGGAAAACTTGG - Intergenic
1187766211 X:22645061-22645083 CTGATTTCCCTAGGAAGTCCAGG + Intergenic
1190319193 X:49169992-49170014 CTGCAATCCCAAGGAAGTCCTGG - Intergenic
1192189689 X:68983318-68983340 ATGGAGTCCCTGGAAAATCTGGG - Intergenic
1194230296 X:91314386-91314408 CTGGAGCCCCTGGAAAATACTGG + Intergenic
1195940468 X:110163424-110163446 CTGGATTTCAAAGGAAATCCAGG - Intronic
1196538293 X:116873806-116873828 GTGGAGACCTTAGGAAATCATGG + Intergenic
1199613879 X:149639946-149639968 CTGCAGTCCTTAGGAAACACAGG + Intergenic
1199627888 X:149757702-149757724 CTGCAGTCCTTAGGAAACACAGG + Intergenic