ID: 1019119966

View in Genome Browser
Species Human (GRCh38)
Location 6:169794567-169794589
Sequence CCAGGCAGGCTCCCCAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019119956_1019119966 7 Left 1019119956 6:169794537-169794559 CCAGGGCCTTGGCAGGCGGCCAC No data
Right 1019119966 6:169794567-169794589 CCAGGCAGGCTCCCCAAGCCAGG No data
1019119951_1019119966 24 Left 1019119951 6:169794520-169794542 CCTCAGGATGGGAGATGCCAGGG No data
Right 1019119966 6:169794567-169794589 CCAGGCAGGCTCCCCAAGCCAGG No data
1019119957_1019119966 1 Left 1019119957 6:169794543-169794565 CCTTGGCAGGCGGCCACCCCAGG No data
Right 1019119966 6:169794567-169794589 CCAGGCAGGCTCCCCAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019119966 Original CRISPR CCAGGCAGGCTCCCCAAGCC AGG Intergenic