ID: 1019120785

View in Genome Browser
Species Human (GRCh38)
Location 6:169801977-169801999
Sequence AGGCAGGGGGTCGCAGCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 187}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019120785_1019120798 -4 Left 1019120785 6:169801977-169801999 CCTGCGGCTGCGACCCCCTGCCT 0: 1
1: 0
2: 1
3: 22
4: 187
Right 1019120798 6:169801996-169802018 GCCTGGGGACGATGGGGTCGGGG 0: 1
1: 0
2: 2
3: 18
4: 228
1019120785_1019120796 -6 Left 1019120785 6:169801977-169801999 CCTGCGGCTGCGACCCCCTGCCT 0: 1
1: 0
2: 1
3: 22
4: 187
Right 1019120796 6:169801994-169802016 CTGCCTGGGGACGATGGGGTCGG 0: 1
1: 0
2: 1
3: 44
4: 348
1019120785_1019120803 25 Left 1019120785 6:169801977-169801999 CCTGCGGCTGCGACCCCCTGCCT 0: 1
1: 0
2: 1
3: 22
4: 187
Right 1019120803 6:169802025-169802047 AGCTGCCCCAGAAACAAGTGGGG 0: 1
1: 0
2: 3
3: 18
4: 171
1019120785_1019120802 24 Left 1019120785 6:169801977-169801999 CCTGCGGCTGCGACCCCCTGCCT 0: 1
1: 0
2: 1
3: 22
4: 187
Right 1019120802 6:169802024-169802046 TAGCTGCCCCAGAAACAAGTGGG 0: 1
1: 0
2: 1
3: 5
4: 119
1019120785_1019120792 -10 Left 1019120785 6:169801977-169801999 CCTGCGGCTGCGACCCCCTGCCT 0: 1
1: 0
2: 1
3: 22
4: 187
Right 1019120792 6:169801990-169802012 CCCCCTGCCTGGGGACGATGGGG 0: 1
1: 0
2: 1
3: 20
4: 220
1019120785_1019120801 23 Left 1019120785 6:169801977-169801999 CCTGCGGCTGCGACCCCCTGCCT 0: 1
1: 0
2: 1
3: 22
4: 187
Right 1019120801 6:169802023-169802045 GTAGCTGCCCCAGAAACAAGTGG 0: 1
1: 0
2: 0
3: 8
4: 132
1019120785_1019120797 -5 Left 1019120785 6:169801977-169801999 CCTGCGGCTGCGACCCCCTGCCT 0: 1
1: 0
2: 1
3: 22
4: 187
Right 1019120797 6:169801995-169802017 TGCCTGGGGACGATGGGGTCGGG 0: 1
1: 0
2: 1
3: 17
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019120785 Original CRISPR AGGCAGGGGGTCGCAGCCGC AGG (reversed) Intergenic
900105376 1:978793-978815 AAGCAGGGGGCCGCAGGGGCCGG - Intronic
900154364 1:1198106-1198128 AGGGAGGGGGTCTCCGCGGCTGG + Intergenic
900384860 1:2405846-2405868 AGAAAGGGGGTCACAGCAGCTGG + Intronic
901257309 1:7841230-7841252 AGGAAGGGGGTCGCACAAGCTGG + Intronic
901878147 1:12178829-12178851 GCGCAGGTGGTGGCAGCCGCTGG + Intronic
902087248 1:13873074-13873096 AGGGAGGGGGTCACAGCCTGAGG - Intergenic
902837767 1:19058038-19058060 GGGCAGCGTGTCACAGCCGCGGG + Intergenic
903028052 1:20443458-20443480 AGGCAGGGGGATGCAGGCCCTGG - Intergenic
903272898 1:22202797-22202819 AGGCTGGGGGTGGCAGCCACAGG - Intergenic
904328639 1:29744034-29744056 AGGCAGCGGGTCGCAGAAGGAGG - Intergenic
904614017 1:31740198-31740220 TGGCAGGGGGTCCTAGCCCCAGG + Intronic
904678468 1:32212785-32212807 AGGCAGGGGGTAGGTGACGCAGG + Exonic
912576096 1:110674297-110674319 AGTCCGGGGGCCGCATCCGCCGG - Exonic
914419672 1:147517855-147517877 GGGCAGCGGGTTGCAGCAGCTGG + Intergenic
914677871 1:149917774-149917796 AGGACGGGGGTCCCGGCCGCGGG + Exonic
918225179 1:182474689-182474711 AGGCAGGGGTCCCCAGCCCCTGG + Intronic
919763927 1:201114600-201114622 AGGGAGGGTGTCGCAGACACGGG + Exonic
920694327 1:208170411-208170433 AGGCAGGGGGAAGCAGGGGCGGG + Intronic
922505257 1:226122255-226122277 AGGCCGGGGGTGGGAGGCGCGGG - Intergenic
922988322 1:229884070-229884092 AGGCTGGGGGTGGCGGCAGCAGG - Intergenic
924073073 1:240303121-240303143 AGGCAGGAGAGCGCAGCCTCAGG - Intronic
1062846725 10:713025-713047 AGGTAGGGGCACGCAGCCACAGG + Intergenic
1064404291 10:15047359-15047381 AGGCAGGGTATCGGAGCCCCTGG - Intronic
1068567122 10:58588618-58588640 AGGCAGGGGCTGGCAGCCTGAGG + Intronic
1069561380 10:69432920-69432942 TGGCATGGAGTCGCAGCAGCAGG + Intergenic
1070757358 10:79001654-79001676 AGGCAGGAGGTGGCAGTGGCTGG + Intergenic
1073108543 10:101047421-101047443 AGGCAGCGGGTCCCAGCGGAGGG + Intergenic
1075220550 10:120580936-120580958 AGGCGGGGGTTGGCAGCCGATGG - Intronic
1075221434 10:120588342-120588364 AGGCAGGGGGGTGCATCTGCAGG - Intronic
1076258647 10:129048709-129048731 AGGCCGGAGCTGGCAGCCGCAGG + Intergenic
1077344053 11:2038296-2038318 TGGCAGGGGGTGGCAGCTGGAGG + Intergenic
1079720493 11:23805787-23805809 AGGCAGGTGGTGGTAGCAGCAGG - Intergenic
1081808599 11:45903069-45903091 AGGCAGGGGGCTGGGGCCGCGGG - Exonic
1083457224 11:62787130-62787152 AGGCTGGGAGGCGCTGCCGCGGG + Exonic
1083883451 11:65559170-65559192 GGGCAGGGGCTGGCAGCGGCTGG + Intergenic
1084111211 11:67015247-67015269 GGGCAGGGGGTCGCAACAGGAGG + Intronic
1087679927 11:101209268-101209290 AGGCAGGGGGCCTCAGCCTTGGG - Intergenic
1089536973 11:119166811-119166833 AGGCAGGGCATCCCAGCAGCAGG - Intronic
1090327890 11:125904594-125904616 AGCCGGGGGGCCACAGCCGCGGG + Intronic
1202827039 11_KI270721v1_random:93485-93507 TGGCAGGGGGTGGCAGCTGGAGG + Intergenic
1091812354 12:3409936-3409958 AGGCAGGGTGTAGCAGCAACTGG + Intronic
1093662698 12:21775029-21775051 CGGCAGGGGGTCGCGGCTACTGG - Intronic
1094481414 12:30885353-30885375 AGGCAGGGTGTAGCAGCAACTGG - Intergenic
1096396480 12:51270117-51270139 GGGCAGAGGGTCGCGGCGGCTGG - Intronic
1098105737 12:67068493-67068515 AGGCAAGGGGGCGCTGCCGCAGG - Intergenic
1102011557 12:109622263-109622285 AGGAAGGGGGTCCCCGCCCCAGG + Intergenic
1104545455 12:129708524-129708546 GGGCTGGGGGTGGCAGCTGCTGG - Intronic
1104843147 12:131834220-131834242 AGCCAGGGGGTGGCTGCCGTGGG + Intronic
1105532360 13:21231272-21231294 AAGCAGTGGGGTGCAGCCGCAGG - Intergenic
1110436244 13:75481244-75481266 AGACAGGGGCTCGGAGGCGCGGG - Intronic
1113766818 13:112887285-112887307 CTGCAGGGGGTGGCAGCCGAGGG - Intergenic
1114499022 14:23154389-23154411 AGGCTGGAGGTTGGAGCCGCTGG + Intronic
1117424496 14:55580457-55580479 GGGCGGGGGGGCGCGGCCGCGGG + Intronic
1117912584 14:60649247-60649269 AGGCAGGGGGCGGCGGCCGCAGG + Exonic
1119400095 14:74357406-74357428 GGGCACGTGGTCGCAGCGGCGGG - Exonic
1121465845 14:94115092-94115114 GGGCAGGGTGTGGCAGCAGCCGG + Intronic
1122879398 14:104683319-104683341 AGGCAGGGAGTGGCAGCCCCAGG - Intergenic
1122921992 14:104884137-104884159 AGGCAGGGGGCCGCAGCTCGGGG + Exonic
1122969683 14:105147502-105147524 AGGCAGAGGGTTGCAGTCGTTGG + Exonic
1125536112 15:40441751-40441773 AGGCAAGGGGCCGCGGCCGGGGG + Intronic
1126134335 15:45376533-45376555 AGTCAGAGGGTAGCAGCAGCAGG + Intronic
1127386718 15:58473096-58473118 AGGCATGAGGTCCCAGCTGCTGG - Intronic
1127876985 15:63120052-63120074 AGGCCGGGGGTCCCAACCCCTGG - Intergenic
1128423976 15:67521205-67521227 AGGCTGGTGTCCGCAGCCGCTGG - Exonic
1129113112 15:73349749-73349771 AGGCAGGAGGTAGCAGCAGTAGG - Intronic
1129676133 15:77633115-77633137 AGGCAGGGGTGCGCAGGCGAGGG + Intronic
1129771097 15:78204093-78204115 AGGCCGGGAGTGGCAGCTGCAGG - Intronic
1131144566 15:90002430-90002452 AGGAAGGGGGGCTGAGCCGCGGG - Intronic
1132513122 16:353648-353670 AGGCAGAGGGTCCTAGCCGGTGG - Intergenic
1132824418 16:1896285-1896307 AGACAGGGGGTCGCTGCCGTGGG + Intergenic
1133024068 16:2980139-2980161 AGGCAGGGGCTCGCGGGGGCGGG + Intronic
1133050157 16:3112871-3112893 GGGCAGGTGGTTGCAGCTGCAGG + Exonic
1133204295 16:4223853-4223875 AGGAAGGGGGTCCCAGGGGCAGG - Intronic
1133219958 16:4315760-4315782 AGGGAGGGCGGCGCGGCCGCGGG - Intronic
1136114708 16:28087393-28087415 AGGCAGGGGGTGGGCGCAGCAGG + Intergenic
1136220167 16:28823413-28823435 AGGCAGGGGGAGGCGGCCGCTGG - Exonic
1136242428 16:28952221-28952243 AGGGAGAGGCACGCAGCCGCTGG + Intronic
1136540030 16:30923889-30923911 GGGCAGGGGGTCGCAGTCCAGGG + Intronic
1142864935 17:2785039-2785061 AGGCAGGGGGATGATGCCGCAGG - Intronic
1143322090 17:6075029-6075051 AGCCAGGGGGTCTCAGCTTCAGG - Intronic
1144371219 17:14593802-14593824 ATGCAGGGGAACGCAGCCTCAGG - Intergenic
1144501244 17:15787719-15787741 AGGCTGGGGGTCACAGCCGGAGG - Intergenic
1145163413 17:20590393-20590415 AGGCTGGGGGTCACAGCCGGAGG - Intergenic
1145208745 17:20997900-20997922 AGGCAGGGCCTCGAAGCCTCCGG - Intergenic
1148244469 17:46021405-46021427 AGGCAGGGCCTCCCAGCCTCGGG + Intronic
1148440258 17:47708526-47708548 GGGCAGGGGGAGGCAGCCGCGGG + Intronic
1148893787 17:50827935-50827957 AGGGTGGGGGTGGGAGCCGCAGG + Intergenic
1152036528 17:77876633-77876655 AGGCAGGGAGCAGCAGCCTCAGG + Intergenic
1152383102 17:79952347-79952369 GGGCAGAGGGTAGCAGCTGCCGG - Intronic
1154488416 18:14898277-14898299 AGTCAGGGGATGGCAGCCGGGGG + Intergenic
1160990106 19:1856970-1856992 GGGCAGGGGCGCGCAGCCGCTGG + Intronic
1162019924 19:7863724-7863746 AGTCAGGAGGCCGCAGCCGCGGG + Intronic
1164208287 19:23075542-23075564 ACGCTGGGGGTCCCGGCCGCGGG - Intronic
1164817259 19:31214235-31214257 AGGAACTGGGTCCCAGCCGCAGG + Intergenic
1165732208 19:38152980-38153002 AGGCGGGTGGGCGCAGCAGCTGG - Intronic
1166567003 19:43771458-43771480 AGCCAGGAAGTGGCAGCCGCAGG + Intronic
1167100856 19:47403525-47403547 AGGCTGGGGGTCACAGCCGGAGG + Exonic
1167502886 19:49857397-49857419 AGGCAGGGCCTTCCAGCCGCAGG - Intronic
1168471219 19:56642790-56642812 GGGCAGGGGGTGGCAGCCCGGGG - Intergenic
927211509 2:20641808-20641830 AGGCAGCGGGAGTCAGCCGCTGG - Intronic
934163784 2:89275911-89275933 AGGCAGGGGGTCTCTGCAGCTGG - Intergenic
934203488 2:89906613-89906635 AGGCAGGGGGTCTCTGCAGCTGG + Intergenic
934535940 2:95133455-95133477 AGGAAGGGGGTGGCAGCAGGAGG + Intronic
934818190 2:97348488-97348510 AGGCAGGTGGTCTCTGCAGCTGG + Intergenic
935292569 2:101622541-101622563 GGGCAGGGGGTCGCCGGCGGGGG - Intergenic
935303610 2:101716023-101716045 AGGCAGGGGGTGGCAGTGGTGGG - Intronic
936010315 2:108921289-108921311 AGACAATGGGTCGCAGCTGCAGG - Intronic
938628531 2:133138878-133138900 ATGCAGGGGGTAGGAGCAGCAGG - Intronic
947729618 2:232420716-232420738 AGCCTGGGAGTCGCAGCCGGCGG + Intergenic
948767399 2:240230320-240230342 AGGCTGGGGGTCCCAGCAGAGGG + Intergenic
948801799 2:240436456-240436478 AGGCCGGGAGTCCCAGCCCCGGG + Intronic
948991937 2:241559790-241559812 AGGCAGGGGGTGGGCGCCCCTGG - Intronic
948992098 2:241560446-241560468 AGGCAGGGGGTTGGAGTCGGAGG + Intronic
1168771588 20:419923-419945 AGGGAGCGGGTCTCAGCCACAGG - Intronic
1169227198 20:3864249-3864271 AGGCTGGAGGTCGCACCTGCCGG - Exonic
1170890044 20:20368728-20368750 GAGCAGCGGGTCGCCGCCGCAGG - Exonic
1174411436 20:50339298-50339320 AGGCAGGGGCTCGGGGCCTCTGG - Intergenic
1175982320 20:62744908-62744930 AGGCAAGGGGTAGCAGCTGAGGG + Intronic
1176363430 21:6017568-6017590 AGGCAGGTGGTCACAGCCCAGGG + Intergenic
1177077002 21:16588557-16588579 GAGCAGGGGGTGGCAGCGGCTGG - Intergenic
1179173148 21:38988634-38988656 AGGCCGGGAGACGCAGCCTCTGG + Intergenic
1179760088 21:43520977-43520999 AGGCAGGTGGTCACAGCCCAGGG - Intergenic
1180070661 21:45434486-45434508 AGGCAGGGAGTCCCAGCCTCTGG - Intronic
1180699591 22:17774223-17774245 AGGCGGGGGGTCAGAGCCCCAGG - Intronic
1180876042 22:19175694-19175716 AAGCAGGGGGCTGCAGCCCCTGG + Exonic
1181695633 22:24591527-24591549 AGGCCGTGGGTCACAGCTGCAGG + Intronic
1182094090 22:27614562-27614584 AGGGACGGGATCTCAGCCGCCGG + Intergenic
1182257694 22:29050313-29050335 GGGCTGGGGCTCGCAGCAGCAGG - Exonic
1183404409 22:37623423-37623445 AGCCAGGGCGGCGCAGCAGCTGG + Exonic
1183953776 22:41367428-41367450 AGGCAGGGGCCGCCAGCCGCAGG - Intronic
1184727867 22:46356889-46356911 AGGCAGACGGCCCCAGCCGCAGG - Exonic
1184773801 22:46613291-46613313 ATGCAGTGGGTCGCGGCAGCCGG - Intronic
1184808495 22:46812270-46812292 AGGCAGGAGGAGGCAGCGGCAGG - Intronic
1185108102 22:48885575-48885597 AGGCCGGGAGTCCCAGCCCCTGG + Intergenic
949414285 3:3799496-3799518 AGGCGGGCGCTTGCAGCCGCGGG - Exonic
965833755 3:172828682-172828704 TGGCATGGAGTCGCAGCAGCAGG + Intergenic
966758387 3:183392825-183392847 AGGCAGGGCCTGCCAGCCGCAGG - Intronic
968450540 4:674120-674142 GGGCCGGGGGTCGCAGCCCGCGG + Intronic
969084048 4:4642027-4642049 GGGCTGGGGCTGGCAGCCGCTGG - Intergenic
969306184 4:6327482-6327504 GGGCAGTGGGTCGCAGCCAGCGG + Intronic
969394149 4:6909827-6909849 AGGCAGCGGGTCCGACCCGCAGG - Exonic
969658148 4:8509778-8509800 AGGCAGGAGGACACAGCCGGGGG + Intergenic
971289732 4:25326181-25326203 ATGCAGGTGGTCCCAGACGCTGG - Intronic
975329602 4:73099257-73099279 AGGATGGGGGTGGCAGCCGGAGG - Intronic
981164635 4:141542646-141542668 AAGCAGGGGTTCCCAGCCCCTGG - Intergenic
981269031 4:142822350-142822372 AAGCAGGGGTTCCCAGCCCCTGG + Intronic
984805297 4:183746481-183746503 AGGCAGGGGGCCGTGCCCGCTGG + Intergenic
984810505 4:183792115-183792137 AGGCAGGGGGTCGCAAGGTCAGG + Intergenic
984844942 4:184100944-184100966 AGGAAGGGGGCTGCAGCTGCTGG + Intronic
985129630 4:186726678-186726700 AGGCAGCGAGTCGCCGCAGCCGG - Intronic
985843295 5:2325759-2325781 AGGCAGGGGGGCTCAGCTGGAGG + Intergenic
986306651 5:6521487-6521509 GGTCAGGGTGGCGCAGCCGCAGG + Intergenic
988555140 5:32229938-32229960 AGGCAGGGGGCCTCAGCCTGGGG + Exonic
989051567 5:37325488-37325510 AGGCAGGGGGCCTCAGCGCCTGG - Intronic
989156808 5:38352144-38352166 AGGCTGGTGGTCTCAGCCGTTGG - Intronic
990308713 5:54518200-54518222 AGGCAGGGGCTCGAAGCCCCCGG - Exonic
993095002 5:83471534-83471556 AGGCAGGCGGTCCCTACCGCAGG + Exonic
995512391 5:112922045-112922067 TGGCCGGGGGTCGCCGCCGCTGG - Intronic
997261197 5:132466641-132466663 GGGCAGGGGTTGGCAGCTGCTGG + Intronic
997976771 5:138445629-138445651 AGGCAGGGGGTGGCGGCTCCAGG + Intronic
998545433 5:143023584-143023606 AGGCAGGAGGAGGCAGCCACCGG + Intronic
1002093490 5:176817840-176817862 AGGCCGGGGGTGGGTGCCGCGGG + Intronic
1002350178 5:178577602-178577624 AGGCAGCGGGGGGCAGGCGCGGG - Intronic
1002792520 6:446601-446623 AGGCAGGGAGCAGCAGGCGCCGG - Intergenic
1004044617 6:12012216-12012238 CGGGCGGGGGCCGCAGCCGCCGG - Intronic
1005254706 6:23988677-23988699 AGGGAGTGGGTCCCAGCCTCTGG - Intergenic
1006599151 6:35214280-35214302 AGGCCGGGGGCTGCAGTCGCGGG - Intergenic
1006902774 6:37513694-37513716 AAGCAGGGGCTGGCTGCCGCAGG + Intergenic
1007114833 6:39336031-39336053 AGGCAGGATGTCCCAGCCACAGG - Exonic
1014137867 6:117908356-117908378 CGGCAAGGGGTCGAAGCCCCCGG - Intronic
1016981620 6:149860168-149860190 AGGCTGGGGGTGGCAGCAGGTGG + Intronic
1018064203 6:160114591-160114613 AGGGAGGGGGTGGGAGCCTCAGG + Intergenic
1018443948 6:163837979-163838001 GAGCAGGGGGTCACAGACGCTGG - Intergenic
1018964761 6:168475797-168475819 AGCCAGTGGGTGGGAGCCGCAGG + Intronic
1019120785 6:169801977-169801999 AGGCAGGGGGTCGCAGCCGCAGG - Intergenic
1019198700 6:170296796-170296818 AGGCGGAGGGTGGCGGCCGCAGG - Intronic
1023232606 7:38050493-38050515 AGGGAGCGGGTTGCAGCTGCTGG - Intergenic
1025194915 7:56925240-56925262 AGGCAGGGGCTCCCAGCTCCAGG + Intergenic
1025677037 7:63651703-63651725 AGGCAGGGGCTCCCAGCTCCAGG - Intergenic
1026479170 7:70763650-70763672 AGGCAGGGAGTCGAAGCCTGGGG + Intronic
1026990200 7:74580766-74580788 GGGCAGGAGGTCGCTGCTGCGGG + Intronic
1029570188 7:101363590-101363612 AGGCTGGGGGTTGGGGCCGCGGG + Intronic
1029620586 7:101688001-101688023 AGGCTGTGGGTCGCAGGCCCAGG - Intergenic
1029679189 7:102096261-102096283 AGTCAGGGGTTAGCGGCCGCAGG - Intronic
1029704725 7:102270240-102270262 AGGCAGGGTGAGGCAGCCGGTGG + Intronic
1034440205 7:151082343-151082365 AGGCTGGGGGTCTCTGCCCCTGG + Exonic
1035169967 7:157011600-157011622 TGGCCGGGGGTCGCAGCGGCAGG - Intergenic
1035399544 7:158555746-158555768 AGGCAGTGGGTGGAACCCGCTGG - Intronic
1036739629 8:11348518-11348540 AGCCAGGGGGTCGCGGCCCGCGG - Intergenic
1037803640 8:22048256-22048278 AGGCAGGGGGCAGCAGCCCCTGG + Exonic
1037879533 8:22566078-22566100 AGGACCGGGGTCGCGGCCGCCGG + Intronic
1038761089 8:30384674-30384696 GGGCTGGGGGCTGCAGCCGCTGG - Exonic
1041281003 8:56211337-56211359 AGGCAGGGGGAGGCAGCGGTGGG - Intergenic
1045981913 8:108199641-108199663 AGGCAGGAGTCCGCAGCCCCTGG - Intergenic
1049034322 8:140062478-140062500 AGGCAGGGAGAAGCAGCAGCTGG - Intronic
1053323478 9:37120653-37120675 AGGCAGGGGTCCCGAGCCGCGGG - Exonic
1053412036 9:37922155-37922177 AGGCAGAGGGTCACAGCCGCTGG + Intronic
1056115082 9:83433933-83433955 AGGCAGGGGTCCCCAGCCCCTGG - Intronic
1058923659 9:109641031-109641053 AGGCAAGGGGTGGGAGCCCCGGG + Intronic
1061357742 9:130119139-130119161 AGGCAGCAGGTCGCAGCCTGGGG - Intronic
1061600855 9:131669121-131669143 AGGCAGGAGGTGGCAGCAGACGG + Intronic
1061693526 9:132354677-132354699 GGACAGGGGGTCGCAGCGGCCGG + Intronic
1062206018 9:135337812-135337834 AGGCAGGGAGACGCAGCTGCAGG - Intergenic
1062352691 9:136147002-136147024 AGGCAGGGGCACGCACCAGCTGG - Intergenic
1062596472 9:137302083-137302105 GGGCCGGGGGTCGCCGCCGCGGG + Exonic
1187207714 X:17198657-17198679 AGGCAAGGGGTTGCAGGTGCTGG - Intergenic
1189309497 X:40009585-40009607 CGGCAGGAGGACGGAGCCGCAGG + Intergenic
1189324453 X:40104606-40104628 GGGCAGGGGGTGGGAGCCTCGGG - Intronic
1189382584 X:40512473-40512495 AGGCAGGGGTTCCCAACCCCAGG + Intergenic
1199772411 X:150983496-150983518 AGGCAGGGGGAGGCGGCGGCAGG - Intronic
1200076746 X:153554927-153554949 AGGCCTGGGTTCGCAGCTGCTGG + Intronic