ID: 1019121004

View in Genome Browser
Species Human (GRCh38)
Location 6:169803358-169803380
Sequence GAACACAAGACAGCTAGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019120998_1019121004 25 Left 1019120998 6:169803310-169803332 CCTCTCCAGGAAGTACATTTGTG No data
Right 1019121004 6:169803358-169803380 GAACACAAGACAGCTAGAGAAGG No data
1019121003_1019121004 -8 Left 1019121003 6:169803343-169803365 CCACAAGATAAGGAAGAACACAA No data
Right 1019121004 6:169803358-169803380 GAACACAAGACAGCTAGAGAAGG No data
1019121001_1019121004 20 Left 1019121001 6:169803315-169803337 CCAGGAAGTACATTTGTGGGCTG No data
Right 1019121004 6:169803358-169803380 GAACACAAGACAGCTAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019121004 Original CRISPR GAACACAAGACAGCTAGAGA AGG Intergenic
No off target data available for this crispr