ID: 1019121492

View in Genome Browser
Species Human (GRCh38)
Location 6:169808424-169808446
Sequence GTGCTTGGACGTCGGTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019121492_1019121502 19 Left 1019121492 6:169808424-169808446 CCCCAGCACCGACGTCCAAGCAC No data
Right 1019121502 6:169808466-169808488 CTCCCAGGTACTGACAACCCAGG No data
1019121492_1019121497 4 Left 1019121492 6:169808424-169808446 CCCCAGCACCGACGTCCAAGCAC No data
Right 1019121497 6:169808451-169808473 TTCCCCAGCACTGACCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019121492 Original CRISPR GTGCTTGGACGTCGGTGCTG GGG (reversed) Intergenic
No off target data available for this crispr