ID: 1019121497

View in Genome Browser
Species Human (GRCh38)
Location 6:169808451-169808473
Sequence TTCCCCAGCACTGACCTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019121488_1019121497 20 Left 1019121488 6:169808408-169808430 CCCTCAGCACTGATCCCCCCAGC No data
Right 1019121497 6:169808451-169808473 TTCCCCAGCACTGACCTCCCAGG No data
1019121495_1019121497 -4 Left 1019121495 6:169808432-169808454 CCGACGTCCAAGCACTGACTTCC No data
Right 1019121497 6:169808451-169808473 TTCCCCAGCACTGACCTCCCAGG No data
1019121489_1019121497 19 Left 1019121489 6:169808409-169808431 CCTCAGCACTGATCCCCCCAGCA No data
Right 1019121497 6:169808451-169808473 TTCCCCAGCACTGACCTCCCAGG No data
1019121494_1019121497 2 Left 1019121494 6:169808426-169808448 CCAGCACCGACGTCCAAGCACTG No data
Right 1019121497 6:169808451-169808473 TTCCCCAGCACTGACCTCCCAGG No data
1019121493_1019121497 3 Left 1019121493 6:169808425-169808447 CCCAGCACCGACGTCCAAGCACT No data
Right 1019121497 6:169808451-169808473 TTCCCCAGCACTGACCTCCCAGG No data
1019121491_1019121497 5 Left 1019121491 6:169808423-169808445 CCCCCAGCACCGACGTCCAAGCA No data
Right 1019121497 6:169808451-169808473 TTCCCCAGCACTGACCTCCCAGG No data
1019121490_1019121497 6 Left 1019121490 6:169808422-169808444 CCCCCCAGCACCGACGTCCAAGC No data
Right 1019121497 6:169808451-169808473 TTCCCCAGCACTGACCTCCCAGG No data
1019121492_1019121497 4 Left 1019121492 6:169808424-169808446 CCCCAGCACCGACGTCCAAGCAC No data
Right 1019121497 6:169808451-169808473 TTCCCCAGCACTGACCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019121497 Original CRISPR TTCCCCAGCACTGACCTCCC AGG Intergenic
No off target data available for this crispr