ID: 1019121816

View in Genome Browser
Species Human (GRCh38)
Location 6:169810338-169810360
Sequence TGCCTAGGGAAGCTGAGCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019121812_1019121816 -3 Left 1019121812 6:169810318-169810340 CCTGTGTTACTCTCCGGCTCTGC No data
Right 1019121816 6:169810338-169810360 TGCCTAGGGAAGCTGAGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019121816 Original CRISPR TGCCTAGGGAAGCTGAGCTT AGG Intergenic
No off target data available for this crispr