ID: 1019122181

View in Genome Browser
Species Human (GRCh38)
Location 6:169812160-169812182
Sequence CCCCAAGTCAGGGTGGGCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019122170_1019122181 -1 Left 1019122170 6:169812138-169812160 CCCACCCCGACGCAACATTGATC No data
Right 1019122181 6:169812160-169812182 CCCCAAGTCAGGGTGGGCTCGGG No data
1019122171_1019122181 -2 Left 1019122171 6:169812139-169812161 CCACCCCGACGCAACATTGATCC No data
Right 1019122181 6:169812160-169812182 CCCCAAGTCAGGGTGGGCTCGGG No data
1019122172_1019122181 -5 Left 1019122172 6:169812142-169812164 CCCCGACGCAACATTGATCCCCA No data
Right 1019122181 6:169812160-169812182 CCCCAAGTCAGGGTGGGCTCGGG No data
1019122168_1019122181 13 Left 1019122168 6:169812124-169812146 CCACGCTCAACCTTCCCACCCCG No data
Right 1019122181 6:169812160-169812182 CCCCAAGTCAGGGTGGGCTCGGG No data
1019122174_1019122181 -7 Left 1019122174 6:169812144-169812166 CCGACGCAACATTGATCCCCAAG No data
Right 1019122181 6:169812160-169812182 CCCCAAGTCAGGGTGGGCTCGGG No data
1019122173_1019122181 -6 Left 1019122173 6:169812143-169812165 CCCGACGCAACATTGATCCCCAA No data
Right 1019122181 6:169812160-169812182 CCCCAAGTCAGGGTGGGCTCGGG No data
1019122166_1019122181 30 Left 1019122166 6:169812107-169812129 CCATGGGTGTGCCTTTGCCACGC No data
Right 1019122181 6:169812160-169812182 CCCCAAGTCAGGGTGGGCTCGGG No data
1019122169_1019122181 3 Left 1019122169 6:169812134-169812156 CCTTCCCACCCCGACGCAACATT No data
Right 1019122181 6:169812160-169812182 CCCCAAGTCAGGGTGGGCTCGGG No data
1019122167_1019122181 19 Left 1019122167 6:169812118-169812140 CCTTTGCCACGCTCAACCTTCCC No data
Right 1019122181 6:169812160-169812182 CCCCAAGTCAGGGTGGGCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019122181 Original CRISPR CCCCAAGTCAGGGTGGGCTC GGG Intergenic
No off target data available for this crispr