ID: 1019124103

View in Genome Browser
Species Human (GRCh38)
Location 6:169827786-169827808
Sequence GAGAATAAAGAGAAGGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019124103_1019124109 10 Left 1019124103 6:169827786-169827808 CCTCCATCCTTCTCTTTATTCTC No data
Right 1019124109 6:169827819-169827841 CCTGCTCTCTTCTTTAGCTTTGG No data
1019124103_1019124110 11 Left 1019124103 6:169827786-169827808 CCTCCATCCTTCTCTTTATTCTC No data
Right 1019124110 6:169827820-169827842 CTGCTCTCTTCTTTAGCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019124103 Original CRISPR GAGAATAAAGAGAAGGATGG AGG (reversed) Intergenic
No off target data available for this crispr