ID: 1019124109

View in Genome Browser
Species Human (GRCh38)
Location 6:169827819-169827841
Sequence CCTGCTCTCTTCTTTAGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019124103_1019124109 10 Left 1019124103 6:169827786-169827808 CCTCCATCCTTCTCTTTATTCTC No data
Right 1019124109 6:169827819-169827841 CCTGCTCTCTTCTTTAGCTTTGG No data
1019124100_1019124109 23 Left 1019124100 6:169827773-169827795 CCTCCTGTCTCTCCCTCCATCCT No data
Right 1019124109 6:169827819-169827841 CCTGCTCTCTTCTTTAGCTTTGG No data
1019124102_1019124109 11 Left 1019124102 6:169827785-169827807 CCCTCCATCCTTCTCTTTATTCT No data
Right 1019124109 6:169827819-169827841 CCTGCTCTCTTCTTTAGCTTTGG No data
1019124104_1019124109 7 Left 1019124104 6:169827789-169827811 CCATCCTTCTCTTTATTCTCTCC No data
Right 1019124109 6:169827819-169827841 CCTGCTCTCTTCTTTAGCTTTGG No data
1019124105_1019124109 3 Left 1019124105 6:169827793-169827815 CCTTCTCTTTATTCTCTCCTCCA No data
Right 1019124109 6:169827819-169827841 CCTGCTCTCTTCTTTAGCTTTGG No data
1019124099_1019124109 26 Left 1019124099 6:169827770-169827792 CCTCCTCCTGTCTCTCCCTCCAT No data
Right 1019124109 6:169827819-169827841 CCTGCTCTCTTCTTTAGCTTTGG No data
1019124101_1019124109 20 Left 1019124101 6:169827776-169827798 CCTGTCTCTCCCTCCATCCTTCT No data
Right 1019124109 6:169827819-169827841 CCTGCTCTCTTCTTTAGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019124109 Original CRISPR CCTGCTCTCTTCTTTAGCTT TGG Intergenic
No off target data available for this crispr