ID: 1019126674

View in Genome Browser
Species Human (GRCh38)
Location 6:169845361-169845383
Sequence CATGGTTACTTCAGGGACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019126668_1019126674 14 Left 1019126668 6:169845324-169845346 CCTGGAATGGAGCTCAGAGCTCT No data
Right 1019126674 6:169845361-169845383 CATGGTTACTTCAGGGACACAGG No data
1019126667_1019126674 15 Left 1019126667 6:169845323-169845345 CCCTGGAATGGAGCTCAGAGCTC No data
Right 1019126674 6:169845361-169845383 CATGGTTACTTCAGGGACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019126674 Original CRISPR CATGGTTACTTCAGGGACAC AGG Intergenic
No off target data available for this crispr