ID: 1019133459

View in Genome Browser
Species Human (GRCh38)
Location 6:169893905-169893927
Sequence GGCCTCCATGCCACAGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019133459_1019133470 23 Left 1019133459 6:169893905-169893927 CCACCTTCTGTGGCATGGAGGCC No data
Right 1019133470 6:169893951-169893973 ATGGAGGAAGAGAATTAGGATGG No data
1019133459_1019133467 7 Left 1019133459 6:169893905-169893927 CCACCTTCTGTGGCATGGAGGCC No data
Right 1019133467 6:169893935-169893957 CCTGGACTTAGTTTCCATGGAGG No data
1019133459_1019133468 19 Left 1019133459 6:169893905-169893927 CCACCTTCTGTGGCATGGAGGCC No data
Right 1019133468 6:169893947-169893969 TTCCATGGAGGAAGAGAATTAGG No data
1019133459_1019133464 4 Left 1019133459 6:169893905-169893927 CCACCTTCTGTGGCATGGAGGCC No data
Right 1019133464 6:169893932-169893954 TGCCCTGGACTTAGTTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019133459 Original CRISPR GGCCTCCATGCCACAGAAGG TGG (reversed) Intergenic
No off target data available for this crispr