ID: 1019133460

View in Genome Browser
Species Human (GRCh38)
Location 6:169893908-169893930
Sequence GGAGGCCTCCATGCCACAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019133460_1019133468 16 Left 1019133460 6:169893908-169893930 CCTTCTGTGGCATGGAGGCCTCC No data
Right 1019133468 6:169893947-169893969 TTCCATGGAGGAAGAGAATTAGG No data
1019133460_1019133470 20 Left 1019133460 6:169893908-169893930 CCTTCTGTGGCATGGAGGCCTCC No data
Right 1019133470 6:169893951-169893973 ATGGAGGAAGAGAATTAGGATGG No data
1019133460_1019133467 4 Left 1019133460 6:169893908-169893930 CCTTCTGTGGCATGGAGGCCTCC No data
Right 1019133467 6:169893935-169893957 CCTGGACTTAGTTTCCATGGAGG No data
1019133460_1019133464 1 Left 1019133460 6:169893908-169893930 CCTTCTGTGGCATGGAGGCCTCC No data
Right 1019133464 6:169893932-169893954 TGCCCTGGACTTAGTTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019133460 Original CRISPR GGAGGCCTCCATGCCACAGA AGG (reversed) Intergenic
No off target data available for this crispr