ID: 1019133462

View in Genome Browser
Species Human (GRCh38)
Location 6:169893926-169893948
Sequence AAACTAAGTCCAGGGCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019133462_1019133473 19 Left 1019133462 6:169893926-169893948 CCTCCATGCCCTGGACTTAGTTT No data
Right 1019133473 6:169893968-169893990 GGATGGTTCTGAGCAGCTTGGGG No data
1019133462_1019133471 17 Left 1019133462 6:169893926-169893948 CCTCCATGCCCTGGACTTAGTTT No data
Right 1019133471 6:169893966-169893988 TAGGATGGTTCTGAGCAGCTTGG No data
1019133462_1019133470 2 Left 1019133462 6:169893926-169893948 CCTCCATGCCCTGGACTTAGTTT No data
Right 1019133470 6:169893951-169893973 ATGGAGGAAGAGAATTAGGATGG No data
1019133462_1019133472 18 Left 1019133462 6:169893926-169893948 CCTCCATGCCCTGGACTTAGTTT No data
Right 1019133472 6:169893967-169893989 AGGATGGTTCTGAGCAGCTTGGG No data
1019133462_1019133468 -2 Left 1019133462 6:169893926-169893948 CCTCCATGCCCTGGACTTAGTTT No data
Right 1019133468 6:169893947-169893969 TTCCATGGAGGAAGAGAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019133462 Original CRISPR AAACTAAGTCCAGGGCATGG AGG (reversed) Intergenic
No off target data available for this crispr