ID: 1019133463

View in Genome Browser
Species Human (GRCh38)
Location 6:169893929-169893951
Sequence TGGAAACTAAGTCCAGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019133463_1019133472 15 Left 1019133463 6:169893929-169893951 CCATGCCCTGGACTTAGTTTCCA No data
Right 1019133472 6:169893967-169893989 AGGATGGTTCTGAGCAGCTTGGG No data
1019133463_1019133470 -1 Left 1019133463 6:169893929-169893951 CCATGCCCTGGACTTAGTTTCCA No data
Right 1019133470 6:169893951-169893973 ATGGAGGAAGAGAATTAGGATGG No data
1019133463_1019133471 14 Left 1019133463 6:169893929-169893951 CCATGCCCTGGACTTAGTTTCCA No data
Right 1019133471 6:169893966-169893988 TAGGATGGTTCTGAGCAGCTTGG No data
1019133463_1019133473 16 Left 1019133463 6:169893929-169893951 CCATGCCCTGGACTTAGTTTCCA No data
Right 1019133473 6:169893968-169893990 GGATGGTTCTGAGCAGCTTGGGG No data
1019133463_1019133468 -5 Left 1019133463 6:169893929-169893951 CCATGCCCTGGACTTAGTTTCCA No data
Right 1019133468 6:169893947-169893969 TTCCATGGAGGAAGAGAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019133463 Original CRISPR TGGAAACTAAGTCCAGGGCA TGG (reversed) Intergenic
No off target data available for this crispr