ID: 1019133465

View in Genome Browser
Species Human (GRCh38)
Location 6:169893934-169893956
Sequence CTCCATGGAAACTAAGTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019133465_1019133471 9 Left 1019133465 6:169893934-169893956 CCCTGGACTTAGTTTCCATGGAG No data
Right 1019133471 6:169893966-169893988 TAGGATGGTTCTGAGCAGCTTGG No data
1019133465_1019133468 -10 Left 1019133465 6:169893934-169893956 CCCTGGACTTAGTTTCCATGGAG No data
Right 1019133468 6:169893947-169893969 TTCCATGGAGGAAGAGAATTAGG No data
1019133465_1019133472 10 Left 1019133465 6:169893934-169893956 CCCTGGACTTAGTTTCCATGGAG No data
Right 1019133472 6:169893967-169893989 AGGATGGTTCTGAGCAGCTTGGG No data
1019133465_1019133473 11 Left 1019133465 6:169893934-169893956 CCCTGGACTTAGTTTCCATGGAG No data
Right 1019133473 6:169893968-169893990 GGATGGTTCTGAGCAGCTTGGGG No data
1019133465_1019133470 -6 Left 1019133465 6:169893934-169893956 CCCTGGACTTAGTTTCCATGGAG No data
Right 1019133470 6:169893951-169893973 ATGGAGGAAGAGAATTAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019133465 Original CRISPR CTCCATGGAAACTAAGTCCA GGG (reversed) Intergenic
No off target data available for this crispr