ID: 1019133466

View in Genome Browser
Species Human (GRCh38)
Location 6:169893935-169893957
Sequence CCTCCATGGAAACTAAGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019133466_1019133470 -7 Left 1019133466 6:169893935-169893957 CCTGGACTTAGTTTCCATGGAGG No data
Right 1019133470 6:169893951-169893973 ATGGAGGAAGAGAATTAGGATGG No data
1019133466_1019133473 10 Left 1019133466 6:169893935-169893957 CCTGGACTTAGTTTCCATGGAGG No data
Right 1019133473 6:169893968-169893990 GGATGGTTCTGAGCAGCTTGGGG No data
1019133466_1019133472 9 Left 1019133466 6:169893935-169893957 CCTGGACTTAGTTTCCATGGAGG No data
Right 1019133472 6:169893967-169893989 AGGATGGTTCTGAGCAGCTTGGG No data
1019133466_1019133471 8 Left 1019133466 6:169893935-169893957 CCTGGACTTAGTTTCCATGGAGG No data
Right 1019133471 6:169893966-169893988 TAGGATGGTTCTGAGCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019133466 Original CRISPR CCTCCATGGAAACTAAGTCC AGG (reversed) Intergenic
No off target data available for this crispr