ID: 1019133470

View in Genome Browser
Species Human (GRCh38)
Location 6:169893951-169893973
Sequence ATGGAGGAAGAGAATTAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019133460_1019133470 20 Left 1019133460 6:169893908-169893930 CCTTCTGTGGCATGGAGGCCTCC No data
Right 1019133470 6:169893951-169893973 ATGGAGGAAGAGAATTAGGATGG No data
1019133466_1019133470 -7 Left 1019133466 6:169893935-169893957 CCTGGACTTAGTTTCCATGGAGG No data
Right 1019133470 6:169893951-169893973 ATGGAGGAAGAGAATTAGGATGG No data
1019133465_1019133470 -6 Left 1019133465 6:169893934-169893956 CCCTGGACTTAGTTTCCATGGAG No data
Right 1019133470 6:169893951-169893973 ATGGAGGAAGAGAATTAGGATGG No data
1019133463_1019133470 -1 Left 1019133463 6:169893929-169893951 CCATGCCCTGGACTTAGTTTCCA No data
Right 1019133470 6:169893951-169893973 ATGGAGGAAGAGAATTAGGATGG No data
1019133459_1019133470 23 Left 1019133459 6:169893905-169893927 CCACCTTCTGTGGCATGGAGGCC No data
Right 1019133470 6:169893951-169893973 ATGGAGGAAGAGAATTAGGATGG No data
1019133462_1019133470 2 Left 1019133462 6:169893926-169893948 CCTCCATGCCCTGGACTTAGTTT No data
Right 1019133470 6:169893951-169893973 ATGGAGGAAGAGAATTAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019133470 Original CRISPR ATGGAGGAAGAGAATTAGGA TGG Intergenic
No off target data available for this crispr