ID: 1019133562

View in Genome Browser
Species Human (GRCh38)
Location 6:169894535-169894557
Sequence AAAGCTGAGCACAGCACTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019133562_1019133568 17 Left 1019133562 6:169894535-169894557 CCTGGAGTGCTGTGCTCAGCTTT No data
Right 1019133568 6:169894575-169894597 ACAGGGACCCCCAGCTCCCGGGG No data
1019133562_1019133569 22 Left 1019133562 6:169894535-169894557 CCTGGAGTGCTGTGCTCAGCTTT No data
Right 1019133569 6:169894580-169894602 GACCCCCAGCTCCCGGGGACAGG No data
1019133562_1019133564 -1 Left 1019133562 6:169894535-169894557 CCTGGAGTGCTGTGCTCAGCTTT No data
Right 1019133564 6:169894557-169894579 TGGCTGATATGTGTTAGAACAGG No data
1019133562_1019133567 16 Left 1019133562 6:169894535-169894557 CCTGGAGTGCTGTGCTCAGCTTT No data
Right 1019133567 6:169894574-169894596 AACAGGGACCCCCAGCTCCCGGG No data
1019133562_1019133565 0 Left 1019133562 6:169894535-169894557 CCTGGAGTGCTGTGCTCAGCTTT No data
Right 1019133565 6:169894558-169894580 GGCTGATATGTGTTAGAACAGGG No data
1019133562_1019133566 15 Left 1019133562 6:169894535-169894557 CCTGGAGTGCTGTGCTCAGCTTT No data
Right 1019133566 6:169894573-169894595 GAACAGGGACCCCCAGCTCCCGG No data
1019133562_1019133573 26 Left 1019133562 6:169894535-169894557 CCTGGAGTGCTGTGCTCAGCTTT No data
Right 1019133573 6:169894584-169894606 CCCAGCTCCCGGGGACAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019133562 Original CRISPR AAAGCTGAGCACAGCACTCC AGG (reversed) Intergenic
No off target data available for this crispr