ID: 1019133569

View in Genome Browser
Species Human (GRCh38)
Location 6:169894580-169894602
Sequence GACCCCCAGCTCCCGGGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019133562_1019133569 22 Left 1019133562 6:169894535-169894557 CCTGGAGTGCTGTGCTCAGCTTT No data
Right 1019133569 6:169894580-169894602 GACCCCCAGCTCCCGGGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019133569 Original CRISPR GACCCCCAGCTCCCGGGGAC AGG Intergenic
No off target data available for this crispr