ID: 1019135794

View in Genome Browser
Species Human (GRCh38)
Location 6:169906883-169906905
Sequence CTTCCCTGCACATCCTCTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019135794_1019135801 2 Left 1019135794 6:169906883-169906905 CCCGCAGAGGATGTGCAGGGAAG No data
Right 1019135801 6:169906908-169906930 AAGGCTTTGGGAAGGTCCCCCGG No data
1019135794_1019135803 8 Left 1019135794 6:169906883-169906905 CCCGCAGAGGATGTGCAGGGAAG No data
Right 1019135803 6:169906914-169906936 TTGGGAAGGTCCCCCGGTCTGGG No data
1019135794_1019135800 -6 Left 1019135794 6:169906883-169906905 CCCGCAGAGGATGTGCAGGGAAG No data
Right 1019135800 6:169906900-169906922 GGGAAGGAAAGGCTTTGGGAAGG No data
1019135794_1019135802 7 Left 1019135794 6:169906883-169906905 CCCGCAGAGGATGTGCAGGGAAG No data
Right 1019135802 6:169906913-169906935 TTTGGGAAGGTCCCCCGGTCTGG No data
1019135794_1019135806 19 Left 1019135794 6:169906883-169906905 CCCGCAGAGGATGTGCAGGGAAG No data
Right 1019135806 6:169906925-169906947 CCCCGGTCTGGGCTCAAGCCAGG No data
1019135794_1019135799 -10 Left 1019135794 6:169906883-169906905 CCCGCAGAGGATGTGCAGGGAAG No data
Right 1019135799 6:169906896-169906918 TGCAGGGAAGGAAAGGCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019135794 Original CRISPR CTTCCCTGCACATCCTCTGC GGG (reversed) Intergenic
No off target data available for this crispr