ID: 1019135993

View in Genome Browser
Species Human (GRCh38)
Location 6:169908001-169908023
Sequence GAGACCCCACCTGGTGCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019135984_1019135993 19 Left 1019135984 6:169907959-169907981 CCTTGTGCAGGACATTAGGAGAA No data
Right 1019135993 6:169908001-169908023 GAGACCCCACCTGGTGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019135993 Original CRISPR GAGACCCCACCTGGTGCTCA GGG Intergenic