ID: 1019139195

View in Genome Browser
Species Human (GRCh38)
Location 6:169932896-169932918
Sequence CATTATCTATGGAGTCTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019139195_1019139197 12 Left 1019139195 6:169932896-169932918 CCTCTCAGACTCCATAGATAATG No data
Right 1019139197 6:169932931-169932953 AACAGCGACGTTATTATTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019139195 Original CRISPR CATTATCTATGGAGTCTGAG AGG (reversed) Intergenic
No off target data available for this crispr