ID: 1019140842

View in Genome Browser
Species Human (GRCh38)
Location 6:169941195-169941217
Sequence GTCCAGGGATGCACCGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019140838_1019140842 -3 Left 1019140838 6:169941175-169941197 CCAGGGAGGGAGGGAGGCTGGTC No data
Right 1019140842 6:169941195-169941217 GTCCAGGGATGCACCGGCCCTGG No data
1019140835_1019140842 2 Left 1019140835 6:169941170-169941192 CCAACCCAGGGAGGGAGGGAGGC No data
Right 1019140842 6:169941195-169941217 GTCCAGGGATGCACCGGCCCTGG No data
1019140831_1019140842 9 Left 1019140831 6:169941163-169941185 CCTCAGGCCAACCCAGGGAGGGA No data
Right 1019140842 6:169941195-169941217 GTCCAGGGATGCACCGGCCCTGG No data
1019140837_1019140842 -2 Left 1019140837 6:169941174-169941196 CCCAGGGAGGGAGGGAGGCTGGT No data
Right 1019140842 6:169941195-169941217 GTCCAGGGATGCACCGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019140842 Original CRISPR GTCCAGGGATGCACCGGCCC TGG Intergenic
No off target data available for this crispr