ID: 1019140948

View in Genome Browser
Species Human (GRCh38)
Location 6:169942041-169942063
Sequence ACGTCCTTCCAGAAAAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019140948_1019140951 -5 Left 1019140948 6:169942041-169942063 CCCTCACTTTTCTGGAAGGACGT No data
Right 1019140951 6:169942059-169942081 GACGTGGCACTAATATTCCATGG No data
1019140948_1019140953 6 Left 1019140948 6:169942041-169942063 CCCTCACTTTTCTGGAAGGACGT No data
Right 1019140953 6:169942070-169942092 AATATTCCATGGAACATTTAGGG No data
1019140948_1019140954 10 Left 1019140948 6:169942041-169942063 CCCTCACTTTTCTGGAAGGACGT No data
Right 1019140954 6:169942074-169942096 TTCCATGGAACATTTAGGGCCGG No data
1019140948_1019140952 5 Left 1019140948 6:169942041-169942063 CCCTCACTTTTCTGGAAGGACGT No data
Right 1019140952 6:169942069-169942091 TAATATTCCATGGAACATTTAGG No data
1019140948_1019140956 18 Left 1019140948 6:169942041-169942063 CCCTCACTTTTCTGGAAGGACGT No data
Right 1019140956 6:169942082-169942104 AACATTTAGGGCCGGCTACTCGG No data
1019140948_1019140957 19 Left 1019140948 6:169942041-169942063 CCCTCACTTTTCTGGAAGGACGT No data
Right 1019140957 6:169942083-169942105 ACATTTAGGGCCGGCTACTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019140948 Original CRISPR ACGTCCTTCCAGAAAAGTGA GGG (reversed) Intergenic
No off target data available for this crispr