ID: 1019143175

View in Genome Browser
Species Human (GRCh38)
Location 6:169961108-169961130
Sequence CTGGACAGAGCTGCCGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019143175_1019143188 26 Left 1019143175 6:169961108-169961130 CCTTTCTCGGCAGCTCTGTCCAG No data
Right 1019143188 6:169961157-169961179 CTGAGCGCCCTCATGGGGATTGG No data
1019143175_1019143181 -10 Left 1019143175 6:169961108-169961130 CCTTTCTCGGCAGCTCTGTCCAG No data
Right 1019143181 6:169961121-169961143 CTCTGTCCAGGGGCTAAGGGAGG No data
1019143175_1019143183 19 Left 1019143175 6:169961108-169961130 CCTTTCTCGGCAGCTCTGTCCAG No data
Right 1019143183 6:169961150-169961172 TGAGTCCCTGAGCGCCCTCATGG No data
1019143175_1019143185 21 Left 1019143175 6:169961108-169961130 CCTTTCTCGGCAGCTCTGTCCAG No data
Right 1019143185 6:169961152-169961174 AGTCCCTGAGCGCCCTCATGGGG No data
1019143175_1019143184 20 Left 1019143175 6:169961108-169961130 CCTTTCTCGGCAGCTCTGTCCAG No data
Right 1019143184 6:169961151-169961173 GAGTCCCTGAGCGCCCTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019143175 Original CRISPR CTGGACAGAGCTGCCGAGAA AGG (reversed) Intergenic