ID: 1019143181

View in Genome Browser
Species Human (GRCh38)
Location 6:169961121-169961143
Sequence CTCTGTCCAGGGGCTAAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019143175_1019143181 -10 Left 1019143175 6:169961108-169961130 CCTTTCTCGGCAGCTCTGTCCAG No data
Right 1019143181 6:169961121-169961143 CTCTGTCCAGGGGCTAAGGGAGG No data
1019143173_1019143181 11 Left 1019143173 6:169961087-169961109 CCTGCGTGGCTCTGACTGATGCC No data
Right 1019143181 6:169961121-169961143 CTCTGTCCAGGGGCTAAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019143181 Original CRISPR CTCTGTCCAGGGGCTAAGGG AGG Intergenic