ID: 1019143182

View in Genome Browser
Species Human (GRCh38)
Location 6:169961127-169961149
Sequence TCTGCACCTCCCTTAGCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019143182_1019143192 29 Left 1019143182 6:169961127-169961149 CCAGGGGCTAAGGGAGGTGCAGA No data
Right 1019143192 6:169961179-169961201 GTCATTTCAGTCCCCATCCTGGG No data
1019143182_1019143191 28 Left 1019143182 6:169961127-169961149 CCAGGGGCTAAGGGAGGTGCAGA No data
Right 1019143191 6:169961178-169961200 GGTCATTTCAGTCCCCATCCTGG No data
1019143182_1019143185 2 Left 1019143182 6:169961127-169961149 CCAGGGGCTAAGGGAGGTGCAGA No data
Right 1019143185 6:169961152-169961174 AGTCCCTGAGCGCCCTCATGGGG No data
1019143182_1019143183 0 Left 1019143182 6:169961127-169961149 CCAGGGGCTAAGGGAGGTGCAGA No data
Right 1019143183 6:169961150-169961172 TGAGTCCCTGAGCGCCCTCATGG No data
1019143182_1019143184 1 Left 1019143182 6:169961127-169961149 CCAGGGGCTAAGGGAGGTGCAGA No data
Right 1019143184 6:169961151-169961173 GAGTCCCTGAGCGCCCTCATGGG No data
1019143182_1019143188 7 Left 1019143182 6:169961127-169961149 CCAGGGGCTAAGGGAGGTGCAGA No data
Right 1019143188 6:169961157-169961179 CTGAGCGCCCTCATGGGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019143182 Original CRISPR TCTGCACCTCCCTTAGCCCC TGG (reversed) Intergenic