ID: 1019143183

View in Genome Browser
Species Human (GRCh38)
Location 6:169961150-169961172
Sequence TGAGTCCCTGAGCGCCCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019143182_1019143183 0 Left 1019143182 6:169961127-169961149 CCAGGGGCTAAGGGAGGTGCAGA No data
Right 1019143183 6:169961150-169961172 TGAGTCCCTGAGCGCCCTCATGG No data
1019143175_1019143183 19 Left 1019143175 6:169961108-169961130 CCTTTCTCGGCAGCTCTGTCCAG No data
Right 1019143183 6:169961150-169961172 TGAGTCCCTGAGCGCCCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019143183 Original CRISPR TGAGTCCCTGAGCGCCCTCA TGG Intergenic