ID: 1019143188

View in Genome Browser
Species Human (GRCh38)
Location 6:169961157-169961179
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019143175_1019143188 26 Left 1019143175 6:169961108-169961130 CCTTTCTCGGCAGCTCTGTCCAG No data
Right 1019143188 6:169961157-169961179 CTGAGCGCCCTCATGGGGATTGG No data
1019143182_1019143188 7 Left 1019143182 6:169961127-169961149 CCAGGGGCTAAGGGAGGTGCAGA No data
Right 1019143188 6:169961157-169961179 CTGAGCGCCCTCATGGGGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019143188 Original CRISPR CTGAGCGCCCTCATGGGGAT TGG Intergenic