ID: 1019144636

View in Genome Browser
Species Human (GRCh38)
Location 6:169968908-169968930
Sequence AGTCCAGGGACAGTGCCCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019144636_1019144646 25 Left 1019144636 6:169968908-169968930 CCCGTGGGCACTGTCCCTGGACT No data
Right 1019144646 6:169968956-169968978 TCAGCTCCAGCTCTGGGCTCTGG No data
1019144636_1019144647 26 Left 1019144636 6:169968908-169968930 CCCGTGGGCACTGTCCCTGGACT No data
Right 1019144647 6:169968957-169968979 CAGCTCCAGCTCTGGGCTCTGGG No data
1019144636_1019144640 -1 Left 1019144636 6:169968908-169968930 CCCGTGGGCACTGTCCCTGGACT No data
Right 1019144640 6:169968930-169968952 TCTTACCATGAGACCTGCTCTGG No data
1019144636_1019144644 18 Left 1019144636 6:169968908-169968930 CCCGTGGGCACTGTCCCTGGACT No data
Right 1019144644 6:169968949-169968971 CTGGGCATCAGCTCCAGCTCTGG No data
1019144636_1019144645 19 Left 1019144636 6:169968908-169968930 CCCGTGGGCACTGTCCCTGGACT No data
Right 1019144645 6:169968950-169968972 TGGGCATCAGCTCCAGCTCTGGG No data
1019144636_1019144641 0 Left 1019144636 6:169968908-169968930 CCCGTGGGCACTGTCCCTGGACT No data
Right 1019144641 6:169968931-169968953 CTTACCATGAGACCTGCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019144636 Original CRISPR AGTCCAGGGACAGTGCCCAC GGG (reversed) Intergenic
No off target data available for this crispr