ID: 1019144945

View in Genome Browser
Species Human (GRCh38)
Location 6:169970541-169970563
Sequence CACAGGAGGCCCCGGGCCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019144945_1019144950 -9 Left 1019144945 6:169970541-169970563 CCACGGGCCCGGGGCCTCCTGTG No data
Right 1019144950 6:169970555-169970577 CCTCCTGTGCCTGCAGAGGCAGG No data
1019144945_1019144952 -6 Left 1019144945 6:169970541-169970563 CCACGGGCCCGGGGCCTCCTGTG No data
Right 1019144952 6:169970558-169970580 CCTGTGCCTGCAGAGGCAGGAGG No data
1019144945_1019144953 -5 Left 1019144945 6:169970541-169970563 CCACGGGCCCGGGGCCTCCTGTG No data
Right 1019144953 6:169970559-169970581 CTGTGCCTGCAGAGGCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019144945 Original CRISPR CACAGGAGGCCCCGGGCCCG TGG (reversed) Intergenic
No off target data available for this crispr