ID: 1019144953

View in Genome Browser
Species Human (GRCh38)
Location 6:169970559-169970581
Sequence CTGTGCCTGCAGAGGCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019144945_1019144953 -5 Left 1019144945 6:169970541-169970563 CCACGGGCCCGGGGCCTCCTGTG No data
Right 1019144953 6:169970559-169970581 CTGTGCCTGCAGAGGCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019144953 Original CRISPR CTGTGCCTGCAGAGGCAGGA GGG Intergenic
No off target data available for this crispr