ID: 1019145250

View in Genome Browser
Species Human (GRCh38)
Location 6:169971747-169971769
Sequence AATTATTCAAAGGGCGCTTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019145250_1019145255 5 Left 1019145250 6:169971747-169971769 CCGCAAGCGCCCTTTGAATAATT No data
Right 1019145255 6:169971775-169971797 GGTGCAGCTTGAAGCCGCCTGGG No data
1019145250_1019145254 4 Left 1019145250 6:169971747-169971769 CCGCAAGCGCCCTTTGAATAATT No data
Right 1019145254 6:169971774-169971796 TGGTGCAGCTTGAAGCCGCCTGG No data
1019145250_1019145256 12 Left 1019145250 6:169971747-169971769 CCGCAAGCGCCCTTTGAATAATT No data
Right 1019145256 6:169971782-169971804 CTTGAAGCCGCCTGGGACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019145250 Original CRISPR AATTATTCAAAGGGCGCTTG CGG (reversed) Intergenic
No off target data available for this crispr