ID: 1019145272

View in Genome Browser
Species Human (GRCh38)
Location 6:169971862-169971884
Sequence GCCCGGGTCCTGCTTGTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019145266_1019145272 4 Left 1019145266 6:169971835-169971857 CCTCACTGGCTTCCTGCAGAGCC No data
Right 1019145272 6:169971862-169971884 GCCCGGGTCCTGCTTGTCACTGG No data
1019145263_1019145272 30 Left 1019145263 6:169971809-169971831 CCTGCCTGCTACTGAGGGATGAC No data
Right 1019145272 6:169971862-169971884 GCCCGGGTCCTGCTTGTCACTGG No data
1019145269_1019145272 -8 Left 1019145269 6:169971847-169971869 CCTGCAGAGCCCAGCGCCCGGGT No data
Right 1019145272 6:169971862-169971884 GCCCGGGTCCTGCTTGTCACTGG No data
1019145264_1019145272 26 Left 1019145264 6:169971813-169971835 CCTGCTACTGAGGGATGACAGAC No data
Right 1019145272 6:169971862-169971884 GCCCGGGTCCTGCTTGTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019145272 Original CRISPR GCCCGGGTCCTGCTTGTCAC TGG Intergenic
No off target data available for this crispr