ID: 1019146890

View in Genome Browser
Species Human (GRCh38)
Location 6:169981388-169981410
Sequence CTGCTCACTGAACCTGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019146873_1019146890 24 Left 1019146873 6:169981341-169981363 CCCGCAGCTCCCATGTCACTGAA No data
Right 1019146890 6:169981388-169981410 CTGCTCACTGAACCTGGAGGGGG No data
1019146877_1019146890 15 Left 1019146877 6:169981350-169981372 CCCATGTCACTGAACCTGGAGGG No data
Right 1019146890 6:169981388-169981410 CTGCTCACTGAACCTGGAGGGGG No data
1019146879_1019146890 14 Left 1019146879 6:169981351-169981373 CCATGTCACTGAACCTGGAGGGG No data
Right 1019146890 6:169981388-169981410 CTGCTCACTGAACCTGGAGGGGG No data
1019146874_1019146890 23 Left 1019146874 6:169981342-169981364 CCGCAGCTCCCATGTCACTGAAC No data
Right 1019146890 6:169981388-169981410 CTGCTCACTGAACCTGGAGGGGG No data
1019146884_1019146890 1 Left 1019146884 6:169981364-169981386 CCTGGAGGGGGCTCAGGGTCCTC No data
Right 1019146890 6:169981388-169981410 CTGCTCACTGAACCTGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019146890 Original CRISPR CTGCTCACTGAACCTGGAGG GGG Intergenic
No off target data available for this crispr