ID: 1019147317

View in Genome Browser
Species Human (GRCh38)
Location 6:169983702-169983724
Sequence TGCCTTGTGGTTTTTCCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019147317_1019147322 -3 Left 1019147317 6:169983702-169983724 CCACAAGGAAAAACCACAAGGCA No data
Right 1019147322 6:169983722-169983744 GCACCTGAGGAAGGGCCGCAAGG No data
1019147317_1019147324 7 Left 1019147317 6:169983702-169983724 CCACAAGGAAAAACCACAAGGCA No data
Right 1019147324 6:169983732-169983754 AAGGGCCGCAAGGTCACTCCAGG No data
1019147317_1019147326 9 Left 1019147317 6:169983702-169983724 CCACAAGGAAAAACCACAAGGCA No data
Right 1019147326 6:169983734-169983756 GGGCCGCAAGGTCACTCCAGGGG No data
1019147317_1019147325 8 Left 1019147317 6:169983702-169983724 CCACAAGGAAAAACCACAAGGCA No data
Right 1019147325 6:169983733-169983755 AGGGCCGCAAGGTCACTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019147317 Original CRISPR TGCCTTGTGGTTTTTCCTTG TGG (reversed) Intergenic
No off target data available for this crispr