ID: 1019152088

View in Genome Browser
Species Human (GRCh38)
Location 6:170013864-170013886
Sequence TTGTATTTCCATTACGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019152088_1019152090 11 Left 1019152088 6:170013864-170013886 CCTTCCACGTAATGGAAATACAA No data
Right 1019152090 6:170013898-170013920 AAGCACAGAATTAACTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019152088 Original CRISPR TTGTATTTCCATTACGTGGA AGG (reversed) Intergenic
No off target data available for this crispr