ID: 1019154932

View in Genome Browser
Species Human (GRCh38)
Location 6:170032418-170032440
Sequence GGGACTCTGGCCCTAACGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019154932_1019154944 10 Left 1019154932 6:170032418-170032440 CCCCACGTTAGGGCCAGAGTCCC No data
Right 1019154944 6:170032451-170032473 CCATCTCCTGGGGCAGCTCATGG No data
1019154932_1019154940 -1 Left 1019154932 6:170032418-170032440 CCCCACGTTAGGGCCAGAGTCCC No data
Right 1019154940 6:170032440-170032462 CAGTGTGGCTCCCATCTCCTGGG No data
1019154932_1019154941 0 Left 1019154932 6:170032418-170032440 CCCCACGTTAGGGCCAGAGTCCC No data
Right 1019154941 6:170032441-170032463 AGTGTGGCTCCCATCTCCTGGGG No data
1019154932_1019154939 -2 Left 1019154932 6:170032418-170032440 CCCCACGTTAGGGCCAGAGTCCC No data
Right 1019154939 6:170032439-170032461 CCAGTGTGGCTCCCATCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019154932 Original CRISPR GGGACTCTGGCCCTAACGTG GGG (reversed) Intergenic