ID: 1019156125

View in Genome Browser
Species Human (GRCh38)
Location 6:170039937-170039959
Sequence GTGGACCAGCAAGAACACAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019156125_1019156133 6 Left 1019156125 6:170039937-170039959 CCTATGTGTTCTTGCTGGTCCAC No data
Right 1019156133 6:170039966-170039988 CTTGCTGGGGCACTGTGTCTGGG No data
1019156125_1019156135 25 Left 1019156125 6:170039937-170039959 CCTATGTGTTCTTGCTGGTCCAC No data
Right 1019156135 6:170039985-170040007 TGGGGCTTACGAAGTACTAGTGG No data
1019156125_1019156134 7 Left 1019156125 6:170039937-170039959 CCTATGTGTTCTTGCTGGTCCAC No data
Right 1019156134 6:170039967-170039989 TTGCTGGGGCACTGTGTCTGGGG No data
1019156125_1019156127 -8 Left 1019156125 6:170039937-170039959 CCTATGTGTTCTTGCTGGTCCAC No data
Right 1019156127 6:170039952-170039974 TGGTCCACCATGTCCTTGCTGGG No data
1019156125_1019156132 5 Left 1019156125 6:170039937-170039959 CCTATGTGTTCTTGCTGGTCCAC No data
Right 1019156132 6:170039965-170039987 CCTTGCTGGGGCACTGTGTCTGG No data
1019156125_1019156128 -7 Left 1019156125 6:170039937-170039959 CCTATGTGTTCTTGCTGGTCCAC No data
Right 1019156128 6:170039953-170039975 GGTCCACCATGTCCTTGCTGGGG No data
1019156125_1019156126 -9 Left 1019156125 6:170039937-170039959 CCTATGTGTTCTTGCTGGTCCAC No data
Right 1019156126 6:170039951-170039973 CTGGTCCACCATGTCCTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019156125 Original CRISPR GTGGACCAGCAAGAACACAT AGG (reversed) Intergenic
No off target data available for this crispr