ID: 1019157210

View in Genome Browser
Species Human (GRCh38)
Location 6:170047321-170047343
Sequence CACAGTGCATGTGGGGCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019157204_1019157210 21 Left 1019157204 6:170047277-170047299 CCTCAGGGGCTGCTTTTTATTGA No data
Right 1019157210 6:170047321-170047343 CACAGTGCATGTGGGGCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019157210 Original CRISPR CACAGTGCATGTGGGGCATG GGG Intergenic
No off target data available for this crispr