ID: 1019157414

View in Genome Browser
Species Human (GRCh38)
Location 6:170048629-170048651
Sequence GTCCTCGGGGAGCACGGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019157399_1019157414 18 Left 1019157399 6:170048588-170048610 CCAAAGACTCTGGGGACTGGTCC No data
Right 1019157414 6:170048629-170048651 GTCCTCGGGGAGCACGGTGGGGG No data
1019157404_1019157414 -3 Left 1019157404 6:170048609-170048631 CCCGGTGGTGGACCTTCGGTGTC No data
Right 1019157414 6:170048629-170048651 GTCCTCGGGGAGCACGGTGGGGG No data
1019157405_1019157414 -4 Left 1019157405 6:170048610-170048632 CCGGTGGTGGACCTTCGGTGTCC No data
Right 1019157414 6:170048629-170048651 GTCCTCGGGGAGCACGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019157414 Original CRISPR GTCCTCGGGGAGCACGGTGG GGG Intergenic
No off target data available for this crispr