ID: 1019158921

View in Genome Browser
Species Human (GRCh38)
Location 6:170056758-170056780
Sequence CTGTGTGGAACTTTATCATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019158914_1019158921 17 Left 1019158914 6:170056718-170056740 CCTGGCCCCTAAACTGATGTTTT No data
Right 1019158921 6:170056758-170056780 CTGTGTGGAACTTTATCATAAGG No data
1019158916_1019158921 11 Left 1019158916 6:170056724-170056746 CCCTAAACTGATGTTTTATTAAC No data
Right 1019158921 6:170056758-170056780 CTGTGTGGAACTTTATCATAAGG No data
1019158917_1019158921 10 Left 1019158917 6:170056725-170056747 CCTAAACTGATGTTTTATTAACC No data
Right 1019158921 6:170056758-170056780 CTGTGTGGAACTTTATCATAAGG No data
1019158915_1019158921 12 Left 1019158915 6:170056723-170056745 CCCCTAAACTGATGTTTTATTAA No data
Right 1019158921 6:170056758-170056780 CTGTGTGGAACTTTATCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019158921 Original CRISPR CTGTGTGGAACTTTATCATA AGG Intergenic
No off target data available for this crispr