ID: 1019158938

View in Genome Browser
Species Human (GRCh38)
Location 6:170056885-170056907
Sequence CTGTAGGTGTGGGGGAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019158938_1019158950 16 Left 1019158938 6:170056885-170056907 CCATCTTTCCCCCACACCTACAG No data
Right 1019158950 6:170056924-170056946 CAAACTGTCTTGAAGCCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019158938 Original CRISPR CTGTAGGTGTGGGGGAAAGA TGG (reversed) Intergenic
No off target data available for this crispr