ID: 1019160033

View in Genome Browser
Species Human (GRCh38)
Location 6:170063411-170063433
Sequence ACCGTGGAGCTGAGCTTCGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019160023_1019160033 29 Left 1019160023 6:170063359-170063381 CCAGGCCTCGGTGGTGTCTGCAA No data
Right 1019160033 6:170063411-170063433 ACCGTGGAGCTGAGCTTCGAAGG No data
1019160026_1019160033 3 Left 1019160026 6:170063385-170063407 CCTGGCCACATGCATCTCCCACC No data
Right 1019160033 6:170063411-170063433 ACCGTGGAGCTGAGCTTCGAAGG No data
1019160024_1019160033 24 Left 1019160024 6:170063364-170063386 CCTCGGTGGTGTCTGCAAAGACC No data
Right 1019160033 6:170063411-170063433 ACCGTGGAGCTGAGCTTCGAAGG No data
1019160027_1019160033 -2 Left 1019160027 6:170063390-170063412 CCACATGCATCTCCCACCCAAAC No data
Right 1019160033 6:170063411-170063433 ACCGTGGAGCTGAGCTTCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019160033 Original CRISPR ACCGTGGAGCTGAGCTTCGA AGG Intergenic