ID: 1019161249

View in Genome Browser
Species Human (GRCh38)
Location 6:170068222-170068244
Sequence CTGGACATTCAGGTCAGACG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019161236_1019161249 26 Left 1019161236 6:170068173-170068195 CCCTCAGCATCAGACATCCTAAG No data
Right 1019161249 6:170068222-170068244 CTGGACATTCAGGTCAGACGAGG No data
1019161235_1019161249 27 Left 1019161235 6:170068172-170068194 CCCCTCAGCATCAGACATCCTAA No data
Right 1019161249 6:170068222-170068244 CTGGACATTCAGGTCAGACGAGG No data
1019161237_1019161249 25 Left 1019161237 6:170068174-170068196 CCTCAGCATCAGACATCCTAAGA No data
Right 1019161249 6:170068222-170068244 CTGGACATTCAGGTCAGACGAGG No data
1019161241_1019161249 -2 Left 1019161241 6:170068201-170068223 CCGCTTGAGCCTGGCCCTGCCCT No data
Right 1019161249 6:170068222-170068244 CTGGACATTCAGGTCAGACGAGG No data
1019161239_1019161249 9 Left 1019161239 6:170068190-170068212 CCTAAGAGTGGCCGCTTGAGCCT No data
Right 1019161249 6:170068222-170068244 CTGGACATTCAGGTCAGACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019161249 Original CRISPR CTGGACATTCAGGTCAGACG AGG Intergenic
No off target data available for this crispr