ID: 1019162298

View in Genome Browser
Species Human (GRCh38)
Location 6:170076691-170076713
Sequence ACAAGGACGTGGAGAGTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019162289_1019162298 20 Left 1019162289 6:170076648-170076670 CCACGTCACCCGGCAGAGTCTGT No data
Right 1019162298 6:170076691-170076713 ACAAGGACGTGGAGAGTCACAGG No data
1019162290_1019162298 12 Left 1019162290 6:170076656-170076678 CCCGGCAGAGTCTGTGCTGTCAC No data
Right 1019162298 6:170076691-170076713 ACAAGGACGTGGAGAGTCACAGG No data
1019162291_1019162298 11 Left 1019162291 6:170076657-170076679 CCGGCAGAGTCTGTGCTGTCACC No data
Right 1019162298 6:170076691-170076713 ACAAGGACGTGGAGAGTCACAGG No data
1019162295_1019162298 -10 Left 1019162295 6:170076678-170076700 CCCTGTGTTAGGGACAAGGACGT No data
Right 1019162298 6:170076691-170076713 ACAAGGACGTGGAGAGTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019162298 Original CRISPR ACAAGGACGTGGAGAGTCAC AGG Intergenic
No off target data available for this crispr