ID: 1019162325

View in Genome Browser
Species Human (GRCh38)
Location 6:170076858-170076880
Sequence CTGTGGGGAAGAAGAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019162325_1019162334 -5 Left 1019162325 6:170076858-170076880 CCCTCCTCTCTTCTTCCCCACAG No data
Right 1019162334 6:170076876-170076898 CACAGGGCTCTGCAGAGTGTGGG No data
1019162325_1019162335 1 Left 1019162325 6:170076858-170076880 CCCTCCTCTCTTCTTCCCCACAG No data
Right 1019162335 6:170076882-170076904 GCTCTGCAGAGTGTGGGACACGG No data
1019162325_1019162336 24 Left 1019162325 6:170076858-170076880 CCCTCCTCTCTTCTTCCCCACAG No data
Right 1019162336 6:170076905-170076927 ACAGTTGCTCAACCCACAGCAGG No data
1019162325_1019162333 -6 Left 1019162325 6:170076858-170076880 CCCTCCTCTCTTCTTCCCCACAG No data
Right 1019162333 6:170076875-170076897 CCACAGGGCTCTGCAGAGTGTGG No data
1019162325_1019162337 25 Left 1019162325 6:170076858-170076880 CCCTCCTCTCTTCTTCCCCACAG No data
Right 1019162337 6:170076906-170076928 CAGTTGCTCAACCCACAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019162325 Original CRISPR CTGTGGGGAAGAAGAGAGGA GGG (reversed) Intergenic
No off target data available for this crispr