ID: 1019163287

View in Genome Browser
Species Human (GRCh38)
Location 6:170083067-170083089
Sequence CTCTCTGGGCAGTGGTGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019163287_1019163293 -6 Left 1019163287 6:170083067-170083089 CCTCCGCACCACTGCCCAGAGAG No data
Right 1019163293 6:170083084-170083106 AGAGAGATGGTCCCAAACCGTGG No data
1019163287_1019163303 26 Left 1019163287 6:170083067-170083089 CCTCCGCACCACTGCCCAGAGAG No data
Right 1019163303 6:170083116-170083138 CCTGAGAGGCGGGACTCACGTGG No data
1019163287_1019163297 12 Left 1019163287 6:170083067-170083089 CCTCCGCACCACTGCCCAGAGAG No data
Right 1019163297 6:170083102-170083124 CGTGGCCTCCTCGTCCTGAGAGG No data
1019163287_1019163298 15 Left 1019163287 6:170083067-170083089 CCTCCGCACCACTGCCCAGAGAG No data
Right 1019163298 6:170083105-170083127 GGCCTCCTCGTCCTGAGAGGCGG No data
1019163287_1019163299 16 Left 1019163287 6:170083067-170083089 CCTCCGCACCACTGCCCAGAGAG No data
Right 1019163299 6:170083106-170083128 GCCTCCTCGTCCTGAGAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019163287 Original CRISPR CTCTCTGGGCAGTGGTGCGG AGG (reversed) Intergenic
No off target data available for this crispr